Primates.nex

From MbWiki

Jump to: navigation, search

#NEXUS
begin data;
dimensions ntax=12 nchar=898;
format datatype=dna interleave=no gap=-;
matrix
Tarsius_syrichta AAGTTTCATTGGAGCCACCACTCTTATAATTGCCCATGGCCTCACCTCCTCCCTATTATTTTGCCTAGCAAATACAAACTACGAACGAGTCCACAGTCGAACAATAGCACTAGCCCGTGGCCTTCAAACCCTATTACCTCTTGCAGCAACATGATGACTCCTCGCCAGCTTAACCAACCTGGCCCTTCCCCCAACAATTAATTTAATCGGTGAACTGTCCGTAATAATAGCAGCATTTTCATGGTCACACCTAACTATTATCTTAGTAGGCCTTAACACCCTTATCACCGCCCTATATTCCCTATATATACTAATCATAACTCAACGAGGAAAATACACATATCATATCAACAATATCATGCCCCCTTTCACCCGAGAAAATACATTAATAATCATACACCTATTTCCCTTAATCCTACTATCTACCAACCCCAAAGTAATTATAGGAACCATGTACTGTAAATATAGTTTAAACAAAACATTAGATTGTGAGTCTAATAATAGAAGCCCAAAGATTTCTTATTTACCAAGAAAGTA-TGCAAGAACTGCTAACTCATGCCTCCATATATAACAATGTGGCTTTCTT-ACTTTTAAAGGATAGAAGTAATCCATCGGTCTTAGGAACCGAAAA-ATTGGTGCAACTCCAAATAAAAGTAATAAATTTATTTTCATCCTCCATTTTACTATCACTTACACTCTTAATTACCCCATTTATTATTACAACAACTAAAAAATATGAAACACATGCATACCCTTACTACGTAAAAAACTCTATCGCCTGCGCATTTATAACAAGCCTAGTCCCAATGCTCATATTTCTATACACAAATCAAGAAATAATCATTTCCAACTGACATTGAATAACGATTCATACTATCAAATTATGCCTAAGCTT Lemur_catta AAGCTTCATAGGAGCAACCATTCTAATAATCGCACATGGCCTTACATCATCCATATTATTCTGTCTAGCCAACTCTAACTACGAACGAATCCATAGCCGTACAATACTACTAGCACGAGGGATCCAAACCATTCTCCCTCTTATAGCCACCTGATGACTACTCGCCAGCCTAACTAACCTAGCCCTACCCACCTCTATCAATTTAATTGGCGAACTATTCGTCACTATAGCATCCTTCTCATGATCAAACATTACAATTATCTTAATAGGCTTAAATATGCTCATCACCGCTCTCTATTCCCTCTATATATTAACTACTACACAACGAGGAAAACTCACATATCATTCGCACAACCTAAACCCATCCTTTACACGAGAAAACACCCTTATATCCATACACATACTCCCCCTTCTCCTATTTACCTTAAACCCCAAAATTATTCTAGGACCCACGTACTGTAAATATAGTTTAAA-AAAACACTAGATTGTGAATCCAGAAATAGAAGCTCAAAC-CTTCTTATTTACCGAGAAAGTAATGTATGAACTGCTAACTCTGCACTCCGTATATAAAAATACGGCTATCTCAACTTTTAAAGGATAGAAGTAATCCATTGGCCTTAGGAGCCAAAAA-ATTGGTGCAACTCCAAATAAAAGTAATAAATCTATTATCCTCTTTCACCCTTGTCACACTGATTATCCTAACTTTACCTATCATTATAAACGTTACAAACATATACAAAAACTACCCCTATGCACCATACGTAAAATCTTCTATTGCATGTGCCTTCATCACTAGCCTCATCCCAACTATATTATTTATCTCCTCAGGACAAGAAACAATCATTTCCAACTGACATTGAATAACAATCCAAACCCTAAAACTATCTATTAGCTT Homo_sapiens AAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAAACTCAAACTACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCACTAATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTCCCTCTACATATTTACCACAACACAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCACACGAGAAAACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTATCCCTCAACCCCGACATCATTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGACAACAGAGGCTTA-CGACCCCTTATTTACCGAGAAAGCT-CACAAGAACTGCTAACTCATGCCCCCATGTCTAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAGGCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGCACACTACTATAACCACCCTAACCCTGACTTCCCTAATTCCCCCCATCCTTACCACCCTCGTTAACCCTAACAAAAAAAACTCATACCCCCATTATGTAAAATCCATTGTCGCATCCACCTTTATTATCAGTCTCTTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTCGAACTGACACTGAGCCACAACCCAAACAACCCAGCTCTCCCTAAGCTT Pan AAGCTTCACCGGCGCAATTATCCTCATAATCGCCCACGGACTTACATCCTCATTATTATTCTGCCTAGCAAACTCAAATTATGAACGCACCCACAGTCGCATCATAATTCTCTCCCAAGGACTTCAAACTCTACTCCCACTAATAGCCTTTTGATGACTCCTAGCAAGCCTCGCTAACCTCGCCCTACCCCCTACCATTAATCTCCTAGGGGAACTCTCCGTGCTAGTAACCTCATTCTCCTGATCAAATACCACTCTCCTACTCACAGGATTCAACATACTAATCACAGCCCTGTACTCCCTCTACATGTTTACCACAACACAATGAGGCTCACTCACCCACCACATTAATAACATAAAGCCCTCATTCACACGAGAAAATACTCTCATATTTTTACACCTATCCCCCATCCTCCTTCTATCCCTCAATCCTGATATCATCACTGGATTCACCTCCTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGACAACAGAGGCTCA-CGACCCCTTATTTACCGAGAAAGCT-TATAAGAACTGCTAATTCATATCCCCATGCCTGACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCCATCCGTTGGTCTTAGGCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGTATACTACCATAACCACCTTAACCCTAACTCCCTTAATTCTCCCCATCCTCACCACCCTCATTAACCCTAACAAAAAAAACTCATATCCCCATTATGTGAAATCCATTATCGCGTCCACCTTTATCATTAGCCTTTTCCCCACAACAATATTCATATGCCTAGACCAAGAAGCTATTATCTCAAACTGGCACTGAGCAACAACCCAAACAACCCAGCTCTCCCTAAGCTT Gorilla AAGCTTCACCGGCGCAGTTGTTCTTATAATTGCCCACGGACTTACATCATCATTATTATTCTGCCTAGCAAACTCAAACTACGAACGAACCCACAGCCGCATCATAATTCTCTCTCAAGGACTCCAAACCCTACTCCCACTAATAGCCCTTTGATGACTTCTGGCAAGCCTCGCCAACCTCGCCTTACCCCCCACCATTAACCTACTAGGAGAGCTCTCCGTACTAGTAACCACATTCTCCTGATCAAACACCACCCTTTTACTTACAGGATCTAACATACTAATTACAGCCCTGTACTCCCTTTATATATTTACCACAACACAATGAGGCCCACTCACACACCACATCACCAACATAAAACCCTCATTTACACGAGAAAACATCCTCATATTCATGCACCTATCCCCCATCCTCCTCCTATCCCTCAACCCCGATATTATCACCGGGTTCACCTCCTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGATAACAGAGGCTCA-CAACCCCTTATTTACCGAGAAAGCT-CGTAAGAGCTGCTAACTCATACCCCCGTGCTTGACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAGGACCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACTATGTACGCTACCATAACCACCTTAGCCCTAACTTCCTTAATTCCCCCTATCCTTACCACCTTCATCAATCCTAACAAAAAAAGCTCATACCCCCATTACGTAAAATCTATCGTCGCATCCACCTTTATCATCAGCCTCTTCCCCACAACAATATTTCTATGCCTAGACCAAGAAGCTATTATCTCAAGCTGACACTGAGCAACAACCCAAACAATTCAACTCTCCCTAAGCTT Pongo AAGCTTCACCGGCGCAACCACCCTCATGATTGCCCATGGACTCACATCCTCCCTACTGTTCTGCCTAGCAAACTCAAACTACGAACGAACCCACAGCCGCATCATAATCCTCTCTCAAGGCCTTCAAACTCTACTCCCCCTAATAGCCCTCTGATGACTTCTAGCAAGCCTCACTAACCTTGCCCTACCACCCACCATCAACCTTCTAGGAGAACTCTCCGTACTAATAGCCATATTCTCTTGATCTAACATCACCATCCTACTAACAGGACTCAACATACTAATCACAACCCTATACTCTCTCTATATATTCACCACAACACAACGAGGTACACCCACACACCACATCAACAACATAAAACCTTCTTTCACACGCGAAAATACCCTCATGCTCATACACCTATCCCCCATCCTCCTCTTATCCCTCAACCCCAGCATCATCGCTGGGTTCGCCTACTGTAAATATAGTTTAACCAAAACATTAGATTGTGAATCTAATAATAGGGCCCCA-CAACCCCTTATTTACCGAGAAAGCT-CACAAGAACTGCTAACTCTCACT-CCATGTGTGACAACATGGCTTTCTCAGCTTTTAAAGGATAACAGCTATCCCTTGGTCTTAGGATCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAACAGCCATGTTTACCACCATAACTGCCCTCACCTTAACTTCCCTAATCCCCCCCATTACCGCTACCCTCATTAACCCCAACAAAAAAAACCCATACCCCCACTATGTAAAAACGGCCATCGCATCCGCCTTTACTATCAGCCTTATCCCAACAACAATATTTATCTGCCTAGGACAAGAAACCATCGTCACAAACTGATGCTGAACAACCACCCAGACACTACAACTCTCACTAAGCTT Hylobates AAGCTTTACAGGTGCAACCGTCCTCATAATCGCCCACGGACTAACCTCTTCCCTGCTATTCTGCCTTGCAAACTCAAACTACGAACGAACTCACAGCCGCATCATAATCCTATCTCGAGGGCTCCAAGCCTTACTCCCACTGATAGCCTTCTGATGACTCGCAGCAAGCCTCGCTAACCTCGCCCTACCCCCCACTATTAACCTCCTAGGTGAACTCTTCGTACTAATGGCCTCCTTCTCCTGGGCAAACACTACTATTACACTCACCGGGCTCAACGTACTAATCACGGCCCTATACTCCCTTTACATATTTATCATAACACAACGAGGCACACTTACACACCACATTAAAAACATAAAACCCTCACTCACACGAGAAAACATATTAATACTTATGCACCTCTTCCCCCTCCTCCTCCTAACCCTCAACCCTAACATCATTACTGGCTTTACTCCCTGTAAACATAGTTTAATCAAAACATTAGATTGTGAATCTAACAATAGAGGCTCG-AAACCTCTTGCTTACCGAGAAAGCC-CACAAGAACTGCTAACTCACTATCCCATGTATGACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAGGACCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAGCAATGTACACCACCATAGCCATTCTAACGCTAACCTCCCTAATTCCCCCCATTACAGCCACCCTTATTAACCCCAATAAAAAGAACTTATACCCGCACTACGTAAAAATGACCATTGCCTCTACCTTTATAATCAGCCTATTTCCCACAATAATATTCATGTGCACAGACCAAGAAACCATTATTTCAAACTGACACTGAACTGCAACCCAAACGCTAGAACTCTCCCTAAGCTT Macaca_fuscata AAGCTTTTCCGGCGCAACCATCCTTATGATCGCTCACGGACTCACCTCTTCCATATATTTCTGCCTAGCCAATTCAAACTATGAACGCACTCACAACCGTACCATACTACTGTCCCGAGGACTTCAAATCCTACTTCCACTAACAGCCTTTTGATGATTAACAGCAAGCCTTACTAACCTTGCCCTACCCCCCACTATCAATCTACTAGGTGAACTCTTTGTAATCGCAACCTCATTCTCCTGATCCCATATCACCATTATGCTAACAGGACTTAACATATTAATTACGGCCCTCTACTCTCTCCACATATTCACTACAACACAACGAGGAACACTCACACATCACATAATCAACATAAAGCCCCCCTTCACACGAGAAAACACATTAATATTCATACACCTCGCTCCAATTATCCTTCTATCCCTCAACCCCAACATCATCCTGGGGTTTACCTCCTGTAGATATAGTTTAACTAAAACACTAGATTGTGAATCTAACCATAGAGACTCA-CCACCTCTTATTTACCGAGAAAACT-CGCAAGGACTGCTAACCCATGTACCCGTACCTAAAATTACGGTTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGACCTTAGGAGTCAAAAACATTGGTGCAACTCCAAATAAAAGTAATAATCATGCACACCCCCATCATTATAACAACCCTTATCTCCCTAACTCTCCCAATTTTTGCCACCCTCATCAACCCTTACAAAAAACGTCCATACCCAGATTACGTAAAAACAACCGTAATATATGCTTTCATCATCAGCCTCCCCTCAACAACTTTATTCATCTTCTCAAACCAAGAAACAACCATTTGGAGCTGACATTGAATAATGACCCAAACACTAGACCTAACGCTAAGCTT M_mulatta AAGCTTTTCTGGCGCAACCATCCTCATGATTGCTCACGGACTCACCTCTTCCATATATTTCTGCCTAGCCAATTCAAACTATGAACGCACTCACAACCGTACCATACTACTGTCCCGGGGACTTCAAATCCTACTTCCACTAACAGCTTTCTGATGATTAACAGCAAGCCTTACTAACCTTGCCCTACCCCCCACTATCAACCTACTAGGTGAACTCTTTGTAATCGCGACCTCATTCTCCTGGTCCCATATCACCATTATATTAACAGGATTTAACATACTAATTACGGCCCTCTACTCCCTCCACATATTCACCACAACACAACGAGGAGCACTCACACATCACATAATCAACATAAAACCCCCCTTCACACGAGAAAACATATTAATATTCATACACCTCGCTCCAATCATCCTCCTATCTCTCAACCCCAACATCATCCTGGGGTTTACTTCCTGTAGATATAGTTTAACTAAAACATTAGATTGTGAATCTAACCATAGAGACTTA-CCACCTCTTATTTACCGAGAAAACT-CGCGAGGACTGCTAACCCATGTATCCGTACCTAAAATTACGGTTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGACCTTAGGAGTCAAAAATATTGGTGCAACTCCAAATAAAAGTAATAATCATGCACACCCCTATCATAATAACAACCCTTATCTCCCTAACTCTCCCAATTTTTGCCACCCTCATCAACCCTTACAAAAAACGTCCATACCCAGATTACGTAAAAACAACCGTAATATATGCTTTCATCATCAGCCTCCCCTCAACAACTTTATTCATCTTCTCAAACCAAGAAACAACCATTTGAAGCTGACATTGAATAATAACCCAAACACTAGACCTAACACTAAGCTT M_fascicularis AAGCTTCTCCGGCGCAACCACCCTTATAATCGCCCACGGGCTCACCTCTTCCATGTATTTCTGCTTGGCCAATTCAAACTATGAGCGCACTCATAACCGTACCATACTACTATCCCGAGGACTTCAAATTCTACTTCCATTGACAGCCTTCTGATGACTCACAGCAAGCCTTACTAACCTTGCCCTACCCCCCACTATTAATCTACTAGGCGAACTCTTTGTAATCACAACTTCATTTTCCTGATCCCATATCACCATTGTGTTAACGGGCCTTAATATACTAATCACAGCCCTCTACTCTCTCCACATGTTCATTACAGTACAACGAGGAACACTCACACACCACATAATCAATATAAAACCCCCCTTCACACGAGAAAACATATTAATATTCATACACCTCGCTCCAATTATCCTTCTATCTCTCAACCCCAACATCATCCTGGGGTTTACCTCCTGTAAATATAGTTTAACTAAAACATTAGATTGTGAATCTAACTATAGAGGCCTA-CCACTTCTTATTTACCGAGAAAACT-CGCAAGGACTGCTAATCCATGCCTCCGTACTTAAAACTACGGTTTCCTCAACTTTTAAAGGATAACAGCTATCCATTGACCTTAGGAGTCAAAAACATTGGTGCAACTCCAAATAAAAGTAATAATCATGCACACCCCCATCATAATAACAACCCTCATCTCCCTGACCCTTCCAATTTTTGCCACCCTCACCAACCCCTATAAAAAACGTTCATACCCAGACTACGTAAAAACAACCGTAATATATGCTTTTATTACCAGTCTCCCCTCAACAACCCTATTCATCCTCTCAAACCAAGAAACAACCATTTGGAGTTGACATTGAATAACAACCCAAACATTAGACCTAACACTAAGCTT M_sylvanus AAGCTTCTCCGGTGCAACTATCCTTATAGTTGCCCATGGACTCACCTCTTCCATATACTTCTGCTTGGCCAACTCAAACTACGAACGCACCCACAGCCGCATCATACTACTATCCCGAGGACTCCAAATCCTACTCCCACTAACAGCCTTCTGATGATTCACAGCAAGCCTTACTAATCTTGCTCTACCCTCCACTATTAATCTACTGGGCGAACTCTTCGTAATCGCAACCTCATTTTCCTGATCCCACATCACCATCATACTAACAGGACTGAACATACTAATTACAGCCCTCTACTCTCTTCACATATTCACCACAACACAACGAGGAGCGCTCACACACCACATAATTAACATAAAACCACCTTTCACACGAGAAAACATATTAATACTCATACACCTCGCTCCAATTATTCTTCTATCTCTTAACCCCAACATCATTCTAGGATTTACTTCCTGTAAATATAGTTTAATTAAAACATTAGACTGTGAATCTAACTATAGAAGCTTA-CCACTTCTTATTTACCGAGAAAACT-TGCAAGGACCGCTAATCCACACCTCCGTACTTAAAACTACGGTTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGCCTTAGGAGTCAAAAATATTGGTGCAACTCCAAATAAAAGTAATAATCATGTATACCCCCATCATAATAACAACTCTCATCTCCCTAACTCTTCCAATTTTCGCTACCCTTATCAACCCCAACAAAAAACACCTATATCCAAACTACGTAAAAACAGCCGTAATATATGCTTTCATTACCAGCCTCTCTTCAACAACTTTATATATATTCTTAAACCAAGAAACAATCATCTGAAGCTGGCACTGAATAATAACCCAAACACTAAGCCTAACATTAAGCTT Saimiri_sciureus AAGCTTCACCGGCGCAATGATCCTAATAATCGCTCACGGGTTTACTTCGTCTATGCTATTCTGCCTAGCAAACTCAAATTACGAACGAATTCACAGCCGAACAATAACATTTACTCGAGGGCTCCAAACACTATTCCCGCTTATAGGCCTCTGATGACTCCTAGCAAATCTCGCTAACCTCGCCCTACCCACAGCTATTAATCTAGTAGGAGAATTACTCACAATCGTATCTTCCTTCTCTTGATCCAACTTTACTATTATATTCACAGGACTTAATATACTAATTACAGCACTCTACTCACTTCATATGTATGCCTCTACACAGCGAGGTCCACTTACATACAGCACCAGCAATATAAAACCAATATTTACACGAGAAAATACGCTAATATTTATACATATAACACCAATCCTCCTCCTTACCTTGAGCCCCAAGGTAATTATAGGACCCTCACCTTGTAATTATAGTTTAGCTAAAACATTAGATTGTGAATCTAATAATAGAAGAATA-TAACTTCTTAATTACCGAGAAAGTG-CGCAAGAACTGCTAATTCATGCTCCCAAGACTAACAACTTGGCTTCCTCAACTTTTAAAGGATAGTAGTTATCCATTGGTCTTAGGAGCCAAAAACATTGGTGCAACTCCAAATAAAAGTAATA---ATACACTTCTCCATCACTCTAATAACACTAATTAGCCTACTAGCGCCAATCCTAGCTACCCTCATTAACCCTAACAAAAGCACACTATACCCGTACTACGTAAAACTAGCCATCATCTACGCCCTCATTACCAGTACCTTATCTATAATATTCTTTATCCTTACAGGCCAAGAATCAATAATTTCAAACTGACACTGAATAACTATCCAAACCATCAAACTATCCCTAAGCTT

end;

Personal tools