Cynmix.nex

From MbWiki

Jump to: navigation, search

#NEXUS

begin data;

dimensions ntax=32 nchar=3246;

format datatype=mixed(Standard:1-166,DNA:167-3246) interleave=yes gap=- missing=?;

matrix

Synergus 1-1-100000000202110201011010110100000000010121001120101010101000000001100020000000111000102010000211010010001001110110000011100000100111000000011112100001001101100005 Periclistus 1-1-100000000202110201011110110100000000010100101000101010011000000001100021001000111000112010000211010010000001110111000011100000100111010000111112100001001111100002 Ceroptres 1-1-1000100002021002010111101001000000000111000???10101010010000000000100021001000111000100000000200010010101001010111000011100000100111100000101112101001100111????05 Synophromorpha 1-1-00001000021-100101001111110100000000010100101000100010010000000000100001200000111000110000000200010010001001000111000011100001120011110000111112100001001101100002 Xestophanes 1-1-00001000011-10-110001011010100000000010110101000100010010101000000100001201000121000110000000100111010001000000111000011100000110011100000010012100000100120001002 Diastrophus 011-10101000021-10-210001011010100000100000011101000100010012000000000001101201100101000110000000100100000000000000011000011100001120011100100000012000000100120001002 Gonaspis 1-1-10001000011-10-210001011010100000100000021101000100010012000000000000101201000100000110000000200110000000000000111000011100101120011100101000010-00000100120001002 Liposthenes_gle 01000030000101022020000010110111000001001000101100001000100120000000010000112011001010001120100001001110000000000000100000100010011210111-0201100012000000000120000003 Liposthenes_ker 0000102000000101????????????????????????????110???0?10001001000000??00000011101100101000112010000????1000000000??????1?1?0100000011210111-01011000???0?000?001?1????03 Antistrophus 1-010120000?01001010000110110001000001020000101???001011111100210000000002210011101210101110200001001100021000000000110000100000011210011-1201000112000000000120????00 Rhodus 1-01000000000000????????????0??????????0????1010000?10101111000000??00000121001110121010112010000????1000200001??????1?000100010011211011-12010000?200?001?001?0????03 Hedickiana 1-01010000000000?????0??10101??????1???0????0010000110101111000000??00000121001100121010111010000???11000100000??????1?000100000011200111012010001??00?001?00??0????03 Neaylax 1-01010000000000100000011010000100010000000000{01}???0110001111000000000000002100110010201011{12}010000100111001000000000011000010000001120011100101000110-00001000110????03 Isocolus 0100001000000100100100011110000100000000000010110001101010110000000000000020000010002000112010000100010001001000000010000010001001020011011100000111000001001100000100 Aulacidea 00000000000001001002000110100001000000000000101???01101010110000000000000021000000000000112010000100010001001000000011000010000001010011110100100111000001001100????00 Panteliella 0000003000100200??1?000????0??010?00????????200???1?101010111020?0??000001210010101200001{12}2110010???11?01100?????00????0?010?000021210111-020000?1?????000100120????03 Barbotinia 1-010100000?0100002000000011000100010200000020010021101010111001000000000021001000100000111000000100110000101000000011000010000001110111110100001012010000100011001101 Aylax 0100002000100101101000010010100110010200000020010021101010110000000003000021001010100000110010000100110000000000001011010010010001120111110200100010-10000000110001101 Iraella 0100003000100100101100010010100110010200000020{01}???21101010110001100000000021000010110010121020000100111000000000001011000000020001120111110100100010-00000000020????01 Timaspis 0000002000100201001100010010100101000000000021100120102010201001100003000021011000111000121001100000111100000100001011000010010000010101100210000010-01000000120000100 Phanacis_1 00011000001001011011000110101001010000000010201???0110201021000010000300012101100012100012102100000011011000000000101100001001000011011111021000001000001000000200??00 Phanacis_2 00000020001002000002010110101001110000000000111???01102010210001100003000021010000122000121021100000110010000010001011000010010000010111100110000010-00000100020????00 Eschatocerus 000010310-1012002002000100101-110?101-0---20112101311--1112100011011120-0021-1001--321-012102110-00010--0011-1-1001001-0-000010001131--01-1200001-10-010-00?0120010106 Diplolepis 000000300010120220020000001011111100120000202110013011-11021100110111201002101001001200011000100000010010001-110001011001000000111010111100210000010-01000000010????02 Pediaspis 000000201011021-20100000001111111100121000{012}021010111100?101101011110010110011011011001-1110001001100101100000010000011001100010001120011100210000010-01010100020001117 Plagiotrochus 000000000110120120010000001201101100121000102000013011-01021001110100001101120001111100012{01}0010011001011001001110110?1011000010002120011100210000000-010-0110120011015 Andricus 0{01}00002001{01}01202200100001012011{01}1000111000{01}0{12}100003111-1101110101010000110{12}1{01}000011020001100000{01}010010{01}0001010110100110110010100{01}2120111110210{01}01110-01111110010011015 Neuroterus 00001031021112022020001000121110111012121020310???3011-0102110101011010110012100010320001200011000001011001001-1011001111001020002120011000200000000-01110110000????15 Biorhiza 010000310211120220200010001201101110121110202100103111-110111011101101011001200001101000110000010100101100100011010001111001020012120011100210000000-01111100020010015 Parnips 1-00000000000100???????????????1????????????11110001111000101000?-??00000021001000021000112000000?0??00100000000?????0?00010?001000001010002110001???-?00??001?1????01 Paramblynotus 0100000002000000100000000000110100000100000010{01}10000001000-0000000000000000000000--00000000001000200100-1-001000000-010000100000000111100-01000000020000000001000???0- Ibalia 000000000000002-000000000000??00000000000000100{01}0100001-00100000-0000000000010000-000000000011010000-0000000000-0---000000000200---01010000100000000-000000??00000000- Synergus TATACTATACTTTATATTTGGTATTTGAACTGGAATAATTGGATCAGCATTAAGATTAATTATTCGTATAGAATTAAGATCAACATTACAATTAATTAATAATGATCAAATTTATAATTCAATTGTAACTGCTCATGCATTTATCATAATTTTTTTTATAGTAATA Periclistus ATTAATATATTTTATTTTAGGGATTTGATCAGGTATAATTGGGTCAAGATTAAGAATAATTATTCGATTAGAACTTGGTAATCCTTTACAATTAATTGGAAATGATCAAATTTATAATTCAATTGTAACTGTTCATGCATTTATTATAATTTTTTTTATAGTTATA Ceroptres TATATTATATTTTATATTTGGGGTATATTCTGGAATAATTGGATCATCCTTAAGAATAATTATTCGAATAGAATTAGGAACTCCTACTCAGTTAATTAATAATGACCAAATTTATAATTCAATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATA Synophromorpha AATACTATATTTTATTTTTGGAATTTGATCTGGTATAATTGGATCTAGATTAAGAATAATTATTCGAATAGAACTTGGTAATCCATCTCAATTAATTGGAAATGATCAAATTTATAATTCAATTGTTACAATTCATGCTTTTATTATAATTTTTTTTATAGTTATA Xestophanes AATATTATATTTTATTTTTGGAATTTGATCTGGTATAATTGGATCTAGATTAAGAATAATTATTCGAATAGAACTTGGAATTCCTACACAATTAATTGGTAATGACCAAATTTATAATTCAATTGTAACAATTCATGCATTTATTATAATTTTTTTTATAGTAATA Diastrophus AATATTATATATAGTTTTTGGTATTTGATCTGGAATAATTGGATCAAGATTAAGAATAATTATTCGTACAGAACTTGGAACTCCTACACAATTAATTGGTAATGATCAAATTTATAACTCAATTGTTACAATTCATGCATTTATTATAATTTTTTTTATAGTAATA Gonaspis TATATTATATATAATTTTTGGTGTTTGATCTGGCATAATTGGGTCTAGATTAAGAATAATTATTCGGACAGAACTTGGTACACCATTACAATTAATTGGTAATGATCAAATTTATAATTCAATTGTTACAACTCATGCATTTATTATAATTTTTTTTATAGTTATA Liposthenes_gle AATTTTATATTTTATTTTTGGTATATGATCAGGTATATTAGGTTCAGCTTTAAGAATGATTATTCGTATAGAGTTAGGGACTCCCTCTCAATTAATTGGAAATGATCAAATTTATAATACAATTGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATGGTTATA Liposthenes_ker AATATTATACTTTATATTTGGAATCTGATCTGGAATAATTGGATCAGGATTAAGAATAATTATCCGTATAGAACTAGGATCCCCCGGCCAACTAATTGGAAATGATCAAATCTATAACTCTATCGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATA Antistrophus TATATTATACTTTTTATTTGGAATTTGATCTGGATTAATTGGATCAGCTTTAAGTATACTTATTCGAATAGAACTAGGAACCCCTTCTCAATTAATTGGTAATGATCAAATTTATAATTCAGTAGTTACTTCTCATGCTTTTGTAATAATTTTTTTTATAGTAATA Rhodus ATTACTTTATTTTTTATTCGGTATATGATCAGGAATAGTTGGAGCAAGATTAAGAGTTATTATCCGTATAGAACTAGGAACCCCCTCTCAACTACTTGAAAATGACCAAGTTTATAATTCAATTGTAACTGCTCATGCATTTATCATAATCTCCTTTATAGTCATA Hedickiana TATATTATATTTTTTATTTGGTGCATGATCTGGGACTATTGGATCTGCATTAAGTATACTTATTCGTAGAGAATTAGGGACTCCAAATCAATTTATTGGAAATGATCAAATTTATAATTCAATTGTCACATCTCATGCATTTGTAATAATTTTTTTTATAGTTATA Neaylax TATATTATACTTTTTATTTGGGATTTGGTCAGGAATTATTGGATCTGCATTAAGAATAATTATTCGAATAGAATTAGGGTCACCCTCCCCATTAATTGGTAATGACCAAATTTATAATTCAATTGTTACTGCTCATGCATTTGTAATAATTTTTTTTATAGTCATG Isocolus AATATTATATTTTTTATTTGGTATTTGATCAGGGATAATTGGGTCTGCTTTGAGAGTAATTATTCGAATAGAGTTAGGGACTCCTGGGCAATTAATTGGAAATGATCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATA Aulacidea AATATTATATTTTTTATTTGGAATTTGATCTGGAATAATTGGATCAGCATTAAGAATAATTATTCGTTTAGAATTAGGGACCTCTGGACAATTAATTGGAGATGATCAAGTTTATAACTCTATTGTTACAGCTCATGCATTCGTAATAATTTTTTTTATAGTTATA Panteliella ATTATTATATTTTATATTTGGTATTTGAGCAGGAATAATTGGGCCAGCTTTAAGAATAATTATTCGTATAGAGTTAGGGTTGCCTTCCCAATTAATTGGAAATGATCAAATTTATAATTCTATTGTTACGGCTCACGCTTTTATTATAATTTTTTTTATAGTTATA Barbotinia AATATTATATTTTATATTTGGAATCTGATCAGGAATAATTGGGTCAGCTTTAAGAATATTAATTCGAATGGAATTAGGTACTCCAGGTCAATTAATTGGTAATGATCAAATTTACAATTCAATTGTTACTATTCATGCATTTATTATAATTTTTTTTATAGTTATA Aylax TATATTATATTTTATATTTGGAATTTGATCTGGAATAATTGGATCTGCTTTAAGTATATTAATTCGAATAGAATTAGGAACACCTAATCAATTAATTGGAAATGATCAAGTTTATAATTCAATTGTTACTACTCATGCATTTATTATAATTTTTTTTATAGTTATA Iraella AATAATATATTTTATTTTTGGTATTTGATCAGGAATAATTGGATCAGCCTTAAGAATATTAATTCGAATAGAATTAGGTACTCCAGGTCAATTAATTGGAAATGATCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATA Timaspis AATATTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGATCAGCTTTAAGAATAATTATTCGTATAGAATTAGGGACTCCTTCACAATTAATTGGTAATGATCAAATTTATAATTCAGTAGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATA Phanacis_1 TATATTATATTTTGTATTTGGGATTTGATCAGGAATAATTGGGTCTGCTTTAAGTATAATTATTCGGATAGAATTAGGTACACCTTCCCAATTAATTGGGAATGATCAGATTTATAATGCTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATA Phanacis_2 GGTATTATATTTTATTTTTGGGATTTGATCTGGTATAATTGGAACAGGATTAAGATTAATTATTCGTATAGAATTAGGGTCTCCTTCACAATTAATTGGGAATGATCAGATTTATAACTCAGTTGTTACTGCTCATGCATTTATTATAATTTTTTTTATGGTTATA Eschatocerus AATCATATATTTTATTTTAGGAATTTGATCAGGAATTTTAGGGGCATCATTAAGTATACTTATTCGAATAGAATTAGGTACCCCTAATCAATTTATTGGAAATGATCAAATTTATAATTCTATTGTAACAGCTCATGCATTTATCATAATTTTCTTTATAGTTATA Diplolepis TGTATTATATTTTATATTTGGTATTTGGTGTGGGATGGTTGGGGCAGCTTTAAGAATAATTATTCGTATTGAGTTAGGAATAACAGGGCAGTTAATTGGTAATGATCAAATTTATAATTCTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATG Pediaspis AATATTATATTTTATTTTTGGAACATGATCTGGAATAATAGGAAGTTCATTAAGAATAATTATTCGAATAGAATTAGGAATACCTGGACAATTAATTAGAAATGATCAAATTTATAATATAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATA Plagiotrochus TATATTATATTTTATATCTGGAATCTGATCAGGATTAATTGGATCAAGATTAAGAATAATTATTCGAATAGAATTAGGAACCCCTTCACAATTAATTGGAAATGATCAACTCTATAACTCAATCGTAACTGCACATGCATTTATTATAATTTTTTTTATAGTTATA Andricus AATATTATATTTTATATTTGGTATTTGATCAGGAATAATTGGATCAGGATTGAGAATAATTATTCGAATAGAGTTAGGGATACCTTTACAATTAATTGGAAATGACCAAATTTATAATTCTATTGTTACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATA Neuroterus AATATTATATTTTATATTTGGAATTTGAGCAGGAATAATTGGATCAGGATTAAGAATAATTATTCGAATAGAATTAGGGATACCTTTACAATTAATTGGAAATGATCAAATTTATAACTCTATTGTTACAGCCCATGCTTTTGTAATAATTTTTTTTATAGTAATA Biorhiza TATAATATATTTTATATTTGGAATTTGATCAGGAATAATTGGATCTAGTTTAAGAATAATTATTCGAATAGAATTAGGGACTCCATTACAATTAATTATAAATGATCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATA Parnips AATATTATATTTTATTTTTGGAATTTGATCAGGAATTATTGGGTCAGCATTAAGAATAATTATTCGAATAGAATTAGGGACTCCTGAACAATTAATTGGGAATGACCAAATTTATAATTCTATTGTGACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATA Paramblynotus TATCTTATATTTTATTTTTGGAATATGAGCAGGAATAATTGGAGCATCAATAAGAATAATTATTCGTATAGAATTAGGTACACCAAATCAATTAATTAATAATGATCAAATTTATAATTCTATTGTAACTGCTCATGCATTTATTATAATTTTTTTTATAGTTATA Ibalia GCTGCTATATTTTATTTTTGGGATTTGATCCGGAATAATTGGATCTAGACTAAGAATAATTATTCGAATAGAATTAGGAGCCCCTTCCCAATTAATTGGGAATGATCAAATTTATAATTCTATTGTAACAATTCATGCTTTTATTATAATTTTTTTTATAGTAATA Synergus CCAATTACAATTGGAGGATTTAGAAATTACCTAATTCCATTAATATTAAGAACTCCTGATATAGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTAATCCCATCTTTAATTTTATTAACATCAAGTATATTTATTGACCAAGGAGCTGGAAGAGGTTGAA Periclistus CCTATTATAGTTGGAGGATTTGGTAATTATTTAATTCCTATTATATTAATTACTCCTGATATGGCTTTTCCTCGATTAAATAATATAAGTTATTGACTTTTAATTCCCTCTTTATTATTAATATTATCTACAATATTTATTGATCAGGGTGCAGGAACAGGATGAA Ceroptres CCTATTATAGTAGGTGGATTTGGAAATTATATGATTCCTTTAATATTAATTTCTCCTGATATAGCATATCCTCGTTTAAATAATATAAGGTTTTGATTATTAATTCCTTCTTTAATTTTATTGATCATGGGAATATTTATTGATCAAGGGGCGGGGACAGGATGAA Synophromorpha CCTATTATAGTTGGTGGATTTGGAAATTATTTAATTCCTTTAATATTATCAGTTCCTGATATAGCTTTTCCACGAATAAATAATATAAGGTATTGACTTTTAATTCCTTCATTATTATTAATAGTATCAAGAATATTTATTGATCAAGGAGCAGGAACAGGATGAA Xestophanes CCTATTATAGTAGGAGGATTTGGAAATTATTTAATTCCTTTAATATTATCTGTACCTGATATAGCTTTTCCTCGAATAAATAATATAAGATATTGACTTTTAGTCCCTTCTTTATTATTAATAATATCTAGAATATTTATTGATCAAGGAGCAGGTACAGGATGAA Diastrophus CCAATTATAGTAGGAGGATTTGGAAATTATTTAATTCCTTTAATATTATCAGTACCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGACTTTTAGTCCCTTCTTTATTATTAATAATTTCTAGTATATGTGTAGATCAAGGGTCTGGTACAGGTTGAA Gonaspis CCTATTATAGTTGGGGGATTTGGAAATTATTTAATTCCTCTTATATTAAGGGTTCCTGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGGCTTTTAATTCCTTCTTTAATATTAATATTATCTAGAATATATGTTGATCAAGGATCAGGGACAGGATGAA Liposthenes_gle CCAATTATAGTAGGAGGATTTGGAAATTATTTAATTCCATTAATATTATCAGTACCTGATATAGCTTTCCCTCGTTTAAATAATTTAAGATATTGAATATTAGTCCCTGCATTATTATTATTATCATCAAGAATGTTTATTGATCAAGGGGCGGGTACAGGTTGAA Liposthenes_ker CCTATTATAGTTGGAGGTTTTGGAAACTATTTAATTCCATTAATAATAACGGCCCCTGATATAGCTTTCCCTCGATTAAATAATATAAGATACTGAATATTAATCCCAGCCTTATTATTATTAATTTCAAGAATATTTATTGATGAAGGTGCTGGAACTGGATGAA Antistrophus CCAATTATAGTAGGGGGATTTGGTAATTATTTAATTCCTTTAATATTATCAGCTCCTGATATAGCTTTCCCACGTTTAAATAATATAAGATTTTGATTATTAATTCCTTCTATATTATTAATATTATCAAGAATTTTTATTGATAGAGGAGCAGGGACTGGATGAA Rhodus CCAATTATAGTAGGAGGATTTGGTAATTATTTAACTCCTCTAATATTATCCTCACCAGACATAGCTTTCCCTCGATTAAATAATATAAGATTCTGATTATTAATCCCAGCATTATTATTATTATTATCTAGAATACTTATTGATCAAGGGGCTGGAACAGGATGAA Hedickiana CCTATTATAGTTGGTGGATTTGGCAATTATTTAATTCCTTTAATAATTTCAGCTCCTGATATAGCTTTCCCTCGATTAAATAATTTAAGATATTGGTTACTTGCCCCAGCTTTATTATTATTATTATCAAATTTATTTATTGATCAGGGGGCTGGGACTGGATGAA Neaylax CCTATTATAGTAGGGGGGTTTGGAAATTATTTAATTCCTTTAATATTAACAGCCCCAGATATAGCTTTCCCACGATTAAATAATATAAGATATTGATTACTACCCCCAGCATTATTTTTATTACTTTCTAGTATATTTATTGATCAAGGGGCAGGGACAGGATGAA Isocolus CCAATTATAGTTGGAGGATTTGGGAATTATTTAGTTCCTTTAATGTTAACTGCCCCAGATATAGCATTCCCTCGATTAAATAATATAAGATATTGGCTTTTAATCCCTTCTTTATTATTAATAATAACAAGAATATTTATTGACCAAGGAGGGGGTACTGGATGAA Aulacidea CCAATTATAGTAGGTGGATTTGGTAATTATTTAATTCCTTTAATATTGACAGCACCTGATATGGCATTTCCACGATTAAATAATATAAGATACTGATTATTACTTCCAGCTTTATTATTAATAATAACTAGGATATTTATTGATCAAGGGGCCGGTACTGGGTGGA Panteliella CCAATTATAGTTGGTGGGTTTGTAAATTATTTAGTTCCATTAATGTTATCAGCCCCTGATATAGCTTTCCCTCGTTTAAATAACATAAGATATTGATTATTAATCCCTTCATTATTACTATTGTTATCTAGAATTTTTATTGATCAGAGGGCAGGGACGGGGTGAA Barbotinia CCTCTTATATTAGGAGGGTTTGGTAATTATTTAATTCCATTAATATTATCAGCTCCTGATATAGCTTTCCCTCGATTAAATAATATAAGATATTGATTATTAATCCCACCATTATTATTATTATTATCAAGAATATTAGTAGATCAAGGGGCAGGGACAGGATGAA Aylax CCTATTATAGTTAGAGGATTTGGTAATTATTTAGTACCTTTAATATTAACAGCTCCTGATATAGCTTTCCCTCGATTAAATAATATAAGATATTGATTATTAATCCCCTCTATATTATTATTATTATCAAGATTATTTATTGATGAAGGGGCAGGGACAGGATGAA Iraella CCAATTATAGTTGGAGGATTTGGAAATTATTTAATTCCTTTAATACTAACAGCACCTGACATAGCTTTTCCACGATTAAATAATATAAGATATTGATTATTAATTCCTTCTTTATTATTATTATTATTAAGAATATTTGTTGATCAGGGAGCTGGAACAGGTTGAA Timaspis CCAATTATAGTAGGAGGATTTGGTAATTATTTAATTCCTTCAATATTAAGAATTCCCGATATAGCTTTCCCTCGAATAAATAATATAAGTTATTGGTTATTAATCCCTTCTTTATTTTTATTATTATCAGGGATATTTATTGATCAAGGGGCTGGAACAGGATGAA Phanacis_1 CCAATTATAGTTGGAGGATTTGGGAATTATTTAGTCCCTTTAATATTAAGAGTTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATATTGATTATTAATCCCAGCTTTATTATTATTATTATCTAGAATAGTAGTTGATCAAGGGGCTGGGACAGGATGAA Phanacis_2 CCTATTATAGTAGGGGGGTTTGGGAATTATTTAATTCCATTAATATTAAGAATTCCTGATATAGCATTTCCTCGAATAAATAATATAAGATATTGATTATTAATCCCTTCATTAATGTTATTATTATCTAGGATAATTGTTGATCAAGGGGCTGGGACAGGATGAA Eschatocerus CCTATTATAATTGGAGGATTTGGTAATTATTTAATTCCTTTAATACTTGGGGTTCCAGATATATGCTTTCCACGATTAAATAATTTAAGATTTTGGTTACTTCTACCTTCTTTAGGTTTATTATTAAGAAGAATGCTTTTAGATTCTGGTGCGGGTACAGGATGAA Diplolepis CCTTTAATATTAGGGGGATTTGGTAATTATTTAATTCCATTAATATTATCTTCTCCAGATATATCTTTTCCTCGATTAAATAATATAAGATTTTGATTATTAGTTCCTTCTTTTATTTTGTTAATTATAAGTATATTTATTGATCAAGGAGCAGGTACAGGGTGAA Pediaspis CCTATTATATTAGGAGGATTTGGTAATTATTTAATTCCTTTAATATTAATAAGACCAGATATATCTTTTCCTCGATTAAATAATTTAAGATTTTGATTATTAATTCCTTCTTTAATTTTATTAACATCAAGAATATTTATTGATCAAGGAGCTGGAACTGGTTGAA Plagiotrochus CCAATTATAGTTGGAGGATTTGGTAATTATTTAATTCCTCTAATATTAATTGCTCCGGATATAGCATTCCCTCGTTTAAATAATATAAGATATTGATTATTAACTCCTGCTCTATTACTATTAATATCAAGAATATTTATTGATCAAGGAGCAGGAACAGGATGAA Andricus CCAATTATAGTTGGGGGGTTTGGAAATTATTTAGTTCCATTAATATTAACTGCTCCTGATATAGCTTTTCCTCGATTAAATAATATAAGATATTGACTTTTAATTCCTTCTTTATTTTTATTATTAGCAGGGATATTAGTTGATCAAGGGGCTGGAACAGGATGAA Neuroterus CCTATTATAGTAGGAGGGTTTGGTAATTATTTAGTTCCTTTAATATTAGCTGCTCCAGATATAGCTTTTCCTCGATTAAATAACATAAGATATTGATTATTAATCCCTTCATTATTATTATTATTAGCCGGAATATTAGTGGACCAAGGGGCAGGAACAGGATGAA Biorhiza CCTATTATAGTTGGAGGATTTGGAAACTATTTAGTGCCTTTAATGTTAGTAATTCCTGATATATCTTTCCCTCGATTAAATAATATAAGATATTGACTTTTAATTCCTTCATTATTTTTATTATTATCTGGTATATTAGTTGATCAGGGAGCTGGAACAGGATGAA Parnips CCTATTATAGTAGGAGGGTTTGGAAATTATTTAGTTCCATTAATATTATCTGCCCCTGATATGGCTTTTCCTCGATTAAATAATATAAGATATTGATTATTAATCCCTTCTTTAATTTTATTAATAATAGGTATATTTGTTGATCAAGGAGCTGGGACTGGGTGAA Paramblynotus CCAATTATAGTTGGAGGGTTTGGAAATTATTTAATTCCAATTATATTAATTTTACCTGATATATCATATCCACGTTTAAATAATATAAGATATTGATTATTACCCCCTTCTTTATTTTTATTAATTTCAAGAATAATAATTGATCAAGGAGCAGGAACTGGATGAA Ibalia CCTATTATAGTAGGGGGATTTGGAAATTATTTAATTCCTTTAATATTAGCAATACCAGATATGGCTTTCCCTCGTTTAAATAATATAAGATTTTGGTTATTAATTCCTGCCCTAATATTTTTAATATCTGGAATATTCATTGATCAGGGAGCAGGGACGGGATGAA

Synergus CAGTTTATCCACCTTTATCTTCAAATTTAGGACATCCAGGAATTTCAGTAGATTTAGCTATTTATTCATTACATATATCAGGAATTTCATCAATTTTAGGTTCAATTAATTTTATTACCACAATTTTAAATATACGTCCTAATTTTATAATAATAGATAAAATTTC Periclistus CTGTTTATCCTCCTTTATCCTCAAATTTAGGTCATAATACAATTTGTGTAGATTTAATTATTTTTTCATTACATTTGACTGGTATTTCTTCAATTTTAGGAGGGATTAATTTTATCACTACAATTTTAAATATACGACCAAATTTAATATCTATAGATAAAATTAC Ceroptres CAGTGTATCCCCCTTTATCTTCTAGGTTAGGGCATTCAGGGTTATCTGTAGATTTAACTATTTATTCATTACATTTAAGAGGAATTTCTTCTATTTTAGGATCCATTAATTTTATTTCTTCTATTATAAATATACGCCCTAAATTAATATTAATAGATAAAATTTC Synophromorpha CTGTGTATCCTCCTTTATCTTCAAATTTAGGTCATAATGGAATATCAGTTGATTTAGTAATTTTTTCTTTACATTTAAGAGGTATTTCTTCAATTTTAGGTTCAATTAATATTATTACTACAATTTTAAATATACGACCTTATTTAATATGTATAGATAAAATTAC Xestophanes CTATTTATCCTCCTTTATCTTCAAATTTAGGACATAATGGTATTTCAGTTGATTTAGTAATTTTTTCTTTACATTTAAGAGGAATTTCATCAATTATAGGATCAATTAATATTATTACTACAATTTTAAATATACGACCATATTTAATATATATAGATAAAATTAC Diastrophus CTGTTTATCCCCCTTTATCTTCAACTTTAGGACATAATGGTATTTCAGTAGATTTAGTAATTTATTCATTACATTTAAGAGGCATTTCATCTATTATAGGGTCAATTAATATTATTACAACAATTTTAAATATACGACCATATTTATTATCTATAGATAAAATTAG Gonaspis CGGTTTATCCTCCTTTATCTTCAATTTTGGGTCATAATGGTATTTCTGTTGATTTAGTAATTTATTCTTTACATTTAAGAGGAGTTTCTTCTATTTTAGGATCTATTAATATTATCACAACAATTTTAAATATACGTCCATATTTATTAAGAATAGATAAAATTAG Liposthenes_gle CAGTATATCCCCCATTGTCATCTAATTTAGGCCATGCAGGGATATCAGTAGATTTAACTATTTATTCTTTACATATAAGAGGAATTTCTTCAATTTTAGGGTCAATTAATTTTATTACAACAATTTTAAATTTACGACCAAATATAGTTAGAATAGATAAAATTTC Liposthenes_ker CAGTTTACCCACCTTTATCATCTTTATTAAGACATAGAGGAATCTCCGTAGATTTAACAATTTATTCCCTTCATATAAGAGGAATTTCATCAATTTTAGGATCAATTAATTTTATCTCAACTATCTTAAACATACGACCCAATAATTTGTCAATAGATAAAATTTC Antistrophus CAATTTACCCCCCACTTTCTTCATTAAATGGTCATTCAGGTATTTCTGTAGATTTAACTATTTATTCATTACATATAAGAGGAATTTCATCAATTTTAGGTTCAATTAATTTTATTACAACAATTTTAAATATACGACCTAATTTAATGTCTATAGATAAAATTAC Rhodus CAATTTACCCCCCATTATCTTCAACCATAGGCCATAATAGAATCTCTATAGATTTAGTTATTTACTCTCTTCATATAAGTGGAATTTCCTCTATTTTAAGATCTATCAATTTTATTACAACTATTTTAAATATACGCCCCCCTATAATCAGAATAGATAAATTATC Hedickiana CAGTTTATCCTCCATTATCTTCTTCTATTGGACATGAAGGAATTTCAGTAGATTTAATTATTTATGCATTACATTTAAGAGGGATCTCTTCAATTTTAGGGTCAATTAATTTTATTACCACTATTTTAAATATACGACCTGAAAAAGTTTCTATAGATAAAATTTC Neaylax CAATTTATCCTCCTTTATCTTCAAGATTAGGCCATATAGGGGTTTCTGTTGATTTAGTGATTTACTCTTTACACTTAAGAGGAGTATCTTCAATTTTAGGGTCAATTAATTTCATTACTACAATTTTAAACATACGCCCAAATATAATTACTATAGATAAAATTTC Isocolus CAGTTTACCCCCCTTTATCTTCAAATATTGGGCATTTAGGAGTTTCAGTAGATTTAATTATTTATTCATTACATATAAGAGGGGTTTCTTCAATTTTAGGGTCAATTAATTTTATTACAACTATTTTAAATATGCGACCTAATAATTTATCAATAGATAAAATTTC Aulacidea CAGTTTATCCACCCTTATCTTCAAATATAGGTCATTCTGGAATTTCAGTTGATCTTGTTATTTATTCATTACACATAAGAGGTATTTCTTCAATTTTAGGGTCCATTAATTTTATTACCACTATTTTAAATATACGACCAAATATATTATCTATAGATAAGATTTC Panteliella CAGTCTACCCTCCATTATCATCAAATTTAGGGCATAGAGGAATATCAGTTGACCTAACAATTTATTCATTACATATAAGAGGGGTATCGTCAATTTTACGATCAATTAATTTTATTACTACAATTTTAAATATGCGTCCTTTATACATATCAATAGATAAAATTTC Barbotinia CGGTTTATCCTCCTTTATCTTCAAATATTGGGCATCCAGGAATTTCAGTAGATTTAACAATTTACTCTTTACATTTAACAGGAATTTCATCGATTTTAGGATCAATTAATTTTATTACAACAATTTTAAATATACGACCAGAAATATTAACTATAGATAAGATTTC Aylax CAGTTTATCCTCCTTTATCTACAGAAGTTAGACATTCAGGTATATCTGTTGATTTAATTATTTATTCTTTACATTTAAGAGGAATTTCTTCTATTTTAGGTTCTATTAATTTTATTACAACAATTTTAAATATACGTCCAAATATATTAACAATAGATAAAATTCC Iraella CAGTTTATCCTCCTTTATCTTCAAATATAGGTCATCCAGGGATCTCTGTAGATCTTACAATTTATTCTTTACATTTAAGAGGGAYTTCTTCAATTTTAGGGTCAATTAACTTTATTACAACTATTTTAAATATACGACCTTATATAGTTACTATAGATAAAATTTC Timaspis CTGTATATCCTCCTTTATCTTCAAATATAGGTCATTTAGGTTTATCAGTAGATTTAACTATTTATTCTTTACATATAAGAGGGGTATCTTCAATTTTAGGGTCTATTAATTTTATTACAACAATTTTAAATATACGACCTTTAATAATATCAATAGATAAAATTTC Phanacis_1 CTGTGTATCCACCTTTATCTTCAAATATTGGTCATTTAGGTATTTCAGTAGATTTAACAATTTATTCATTACATATAAGAGGAATTTCATCAATTTTAGGATCAATTAATTTTATTACTACAATTTTAAATATACGACCTTTAAAAATAATAATAGATAAAGTTAC Phanacis_2 CTGTTTATCCTCCTTTATCTTCTAATATAGGGCATTTAGGAATATCAGTTGATTTAACTATTTACTCTTTACATATAAGGGGGGTTTCTTCTATTTTAGGATCAATTAATTTTATTACTACTATTTTAAATATACGACCCATAAAAATAACTATAGATAAAATTGC Eschatocerus CAGTTTATCCTCCTTTATCTTCTCTTATTGGACATCCTGGAGTATCTGTTGATTTTGCAATTTTTTCTTTACATTTAAGGGGAGCATCCTCTATTTTAGGATCTATTAACTTTATTTCCACAATTATTAATATACGGACAATGAAATTTTCAATAGATAAAATTTC Diplolepis CTGTTTATCCTCCATTATCATTAAATATTGGGCATGAAGGGGTTTCTGTTGATTTAGTAATTTTTTCATTACATTTAAGTGGGATTTCATCAATTTTAGGTTCAATTAATTTTATTACTACAATTTTAAATATACGTCCTGTAATAATAAGAATAGAAAAAATTAC Pediaspis CTATTTACCCTCCTTTATCTTCAAATATAGGTCATATAGGAATTTCTATGGATTTAATTATTTTTTCTTTACATATAAGTGGAATATCTTCAATTTTAGGTTCAATTAATTTTATTACTACTATTTTAAATATACGTCCATTAAATTTAACTATAGATAAAATTTC Plagiotrochus CCATTTACCCCCCATTATCATCCAATTTAGGACATTCAGGAATTTCAGTNGATTTGACTATTTATTCTCTTCATATAAGAGGAATTTCTTCAATTTTAGGATCAATTAATTTCATTACAACAATTTTAAATATACGCCCTTATTTAATATCTATAGATAAAATTCC Andricus CTGTTTATCCTCCTTTATCTTCAAATTTAGGACACCCAGGAATTTCTGTTGATTTAACTATTTATTCTTTACATTTAACTGGGATTTCCTCAATTTTAGGTTCAATTAATTTTATTACAACAATTTTAAATATACGACCTAATTTAATAGATATAGATAAAATCCC Neuroterus CTGTTTATCCTCCTTTATCCTCAAATTTAGGGCATCCAGGTATCTCTGTAGACTTAACTATTTATTCTTTACATTTAACAGGAATTTCTTCAATTTTAGGTTCAATTAATTTTATTACTACAATTTTAAATATACGTCCTAATTTAATAGAAATAGATAAAATTCC Biorhiza CTGTTTACCCTCCTTTATCTTCAAATTTAGGACATTCAGGAATTTCTGTTGATTTAACAATTTATTCTTTACATTTAACTGGAATTTCTTCAATTTTAGGATCAATTAATTTTATTACTACAATTTTAAATATACGATCTAATTTAATAACAATAGATAAAATTCC Parnips CTGTTTACCCTCCTTTATCAGCAAATTTAGGTCATCCAGGAGTTTCAGTTGATTTAACTATTTTTTCTTTACATTTAAGTGGAATTTCATCTATTTTAGGATCAATTAATTTTATTTCAACTATTTTAAATATACGACCTAATTATGTATCTATAGATAAAATTTC Paramblynotus CTGTTTATCCTCCTCTTTCATCAAATTTAGGTCATAGAGGAATTTCTGTAGATTTAACAATTTTTTCTTTACATTTAAGTGGTGTATCTTCAATTTTAGGATCAATTAATTTTATTACTACAATTTTAAATATACGATTAAATAATATAAGTATAGATAAAATTAC Ibalia CAGTTTATCCTCCTTTATCTTCTTATTTAGGCCACCCTAGGATTTCAGTTGATTTAACTATTTTTTCTTTACATTTAAGGGGAGTTTCTTCTATTTTAGGTTCTATTAATTTTATTACAACTATTTTAAATATACGA------ATTATAATAATAGATAAAATTAC

Synergus ACTATTTATTTGATCAATTTTACTAACTACAATCTTATTATTATTATCATTACCTGTTCTAGCTGGAGGAATTACAATATTATTATTCGATCGTAATATAAACACATCATTTTTTGACCCTATAGGAGGAGGAGACCCTATCTTATATCAACACTTATTTTGATTT Periclistus TTTATTTGTTTGATCTATTTTTTTAACAGTAATTTTATTAGTAGTTTCTCTCCCAGTATTAGCTGGTGGTATTACAATATTATTATTTGATCGAAATATAAATACTTCTTTTTTTGATCCATTAGGAGGTGGAGATCCTATTTTATATCAACATTTATTTTGATTT Ceroptres TTTATTTATTTGATCAATTTTATTAACTACTATTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGGAATTACAATATTATTATTTGATCGAAATATAAATACTTCATTTTTTGATCCTATAGGAGGAGGTGACCCAATTTTATATCAACATTTATTTTGATTT Synophromorpha TTTATTTATTTGATCTTTTATTTTAACAACAATTTTATTATTATTATCATTACCTGTATTAGCAGGAGGAATTACAATATTATTATTTGATCGAAATATAAATTCTTCTTTTTTTGATCCATTAGGAGGTGGTGATCCTATTCTTTATCAACATTTATTTTGATTT Xestophanes TTTATTTATTTGATCTTTATTTTTAACTACAATTTTATTATTATTATCATTACCTGTATTAGCTGGGGGAATTACAATATTATTATTTGATCGAAATATAAATTCTTCTTTTTTTGATCCATTAGGAGGAGGAGACCCTATTCTTTATCAACATTTATTTTGATTT Diastrophus TTTATTTACTTGATCTATCTTTTTAACTACTATTTTATTATTATTATCTTTACCAGTGTTAGCCGGAGGAATTACTATATTATTAATAGATCGAAATATAAATTCTTCTTTTTTTGACCCTTTAGGAGGAGGGGATCCTATTCTTTATCAACATTTATTTTGATTT Gonaspis GTTATTTATTTGATCTATTTTATTAACAACTATTTTATTATTATTATCTTTACCAGTTTTAGCAGGAGGAATTACTATATTATTAATAGATCGAAATATAAATTCTTCTTTTTTCGATCCGTTAGGTGGAGGAGATCCTATTCTTTATCAACATTTATTTTGATTT Liposthenes_gle TTTATTTATATGATCAATTTTTTTAACTACTATTTTACTTTTATTATCTTTACCAGTGTTAGCGGGAGGAATTACAATATTATTATTTGACCGAAATTTAAATACTTCGTTTTTTGACCCCTTAGGAGGAGGAGACCCTATTTTATATCAACATTTATTTTGATTT Liposthenes_ker TTTATTTTCCTGATCAATTTTACTAACGACAACTTTATTATTATTATCATTGCCAGTATTAGCAGGAGGAATTACAATACTTCTTTTTGACCGTAATATAAATACTTCTTTTTTTGACCCTATAGGAGGAGGAGACCCAATTTTATATCAACATCTATTTTGATTC Antistrophus ATTATTTTCTTGATCAATTATATTAACAACTATTTTATTATTATTATCTTTACCAGTTTTAGCTGGAGGAATTACAATATTACTCTTTGATCGAAATATAAATACATCTTTTTTTGATCCTTTAGGGGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTT Rhodus ATTATTTTTATGGTCCATTTTATTAACTACTATTTTATTATTACTTTCCTTACCCGTCTTAGCTGGTGGAATTACAATATTACTTTTTGATCGAAATTTTAATACCTCCTTTTTTGACCCTATAGGAGGTGGAGACCCAATCTTATTCCAACATTTATTTTGATTC Hedickiana ATTATTTTCATGATCTATTTTATTAACAACAATTTTACTTTTACTTTCTTTACCTGTATTAGCAGGAGGTATTACAATATTACTTTTTGATCGTAATTTAAATACATCTTTTTTTGACCCAATAGGAGGGGGGGATCCAATTTTATACCAACATTTATTTTGATTT Neaylax TTTATTTCTATGATCAATTTTTTTAACTACAATTTTACTATTACTTTCATTACCTGTATTAGCCGGGGGGATTACAATATTATTATTTGATCGAAACTTAAACACATCTTTCTTTGACCCAATAGGAGGAGGAGACCCTATTTTATTCCAGCATTTATTTTGATTT Isocolus TTTATTTATTTGATCAATTTTATTAACAACAATTTTATTATTATTATCTTTACCTGTGTTAGCTGGAGGAATTACTATATTATTATTTGACCGAAATTTAAATACTTCTTTTTTTGACCCTATAGGAGGAGGAGACCCAATTTTATACCAACATTTATTTTGATTT Aulacidea ATTATTTATATGGTCAATTTCTTTAACAACAATTTTATTATTATTATCATTGCCTGTATTAGCTGGAGGAATTACAATATTATTATTTGATCGAAATATAAATACTTCATTTTTTGACCCTATAGGAGGAGGAGACCCTGTGTTATATCAACATTTATTTTGATTT Panteliella ATTATTCATGTGAACTATTCTATTAACTACTATTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGGAATTACAATATTATTATTTGATCGTAATTTAAATACCTCATTTTTTGATCCTGTAGGCGGGGGAGAGCCAGTATTATACCAACATTTATTTTGATTT Barbotinia TTTATTTATTTGATCAATTTTTTTAACAACTATTTTACTATTACTTTCTTTACCTGTTTTAGCTGGAGGAATTACAATATTATTATTTGATCGTAATATAAATACTTCATTTTTTGATCCAATAGGAGGGGGTGACCCAATTTTATATCAACATTTATTTTGATTT Aylax TTTATTTATTTGATCTATTTTTTGAACAACAATTTTATTATTATTATCTTTACCAGTTTTAGCTGGGGGAATTACAATATTATTATTTGATCGGAATATAAATACATCTTTTTTTGACCCTATAGGGGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTT Iraella TTTATTTATTTGATCAATTTTTTTAACAACAATTTTATTATTATTATCTTTACCAGTATTAGCAGGTGGAATTACAATATTATTATTTGATCGTAATATAAATACTTCATTTTTTGACCCAATAGGAGGAGGAGATCCAGTATTATATCAACATTTATTTTGATTT Timaspis TTTATTTGTATGATTTATTTTTTTAACAACTATTTTATTACTATTATCTTTACCTGTTTTAGCAGGAGGGATTACAATATTATTATTTGATCGAAATTTAAATACTTCTTTTTTTGACCCTATAGGAGGAGGAGATCCTGTATTATATCAACATTTATTTTGATTT Phanacis_1 TTTATTTGTTTGATCAATTTTTTCAACAACTATTTTATTATTATTATCTTTACCAGTTCTTGCTGGAGGTATTACTATATTATTATTTGATCGAAATTTAAATACTTCATTTTTTGACCCTATAGGAGGAGGAGACCCAGTATTATACCAACATTTATTTTGATTT Phanacis_2 TTTATTTGTTTGATCGATTTTTTTAACAACAATTTTACTATTATTATCTTTACCTGTATTAGCGGGAGGAATTACAATATTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCTATAGGAGGGGGGGACCCTGTATTATACCAACATTTATTTTGATTT Eschatocerus TTTGTTTGTTTGATCTATTTTATTAACTACTATTTTATTATTATTATCTTTACCTGTATTAGCAGGAGGAATTACAATACTTTTATTTGATCGAAATCTAAATACTTCTTTCTTTGACCCTATTGGAGGTGGGGACCCCATTTTATATCAACATTTATTTTGATTT Diplolepis TTTATTTTCTTGATCAATTTTATTAACTACTATTTTATTATTATTGTCTTTACCTGTTTTAGCTGGGGGTATTACTATATTATTATTTGATCATAATTTAAATACTTCTTTCTTTGATCCTATAGGGGGCGGGGATCCAGTTTTATATCAACATTTATTTTGATTT Pediaspis ATTATTTACATGATCAATTTTATTAACAACAATTTTATTATTATTATCATTACCTGTTTTAGCTGGAGGAATTACAATATTATTATTTGATCGTAATTTAAATACTACTTTTTTTGATCCTATAGGAGGCGGAGATCCAATTTTATTTCAACATTTATTTTGATTT Plagiotrochus TCTTTTTGTATGATCAATTTTTTTAACTACAATTTTATTATTATTATCATTACCAGTATTAGCAGGTGCAATTACTATGTTACTTTTTGATCGAAATATAAATACTTCTTTTTTTGACCCAACTGGAGGAGGAGATCCTATCTTATATCAACATTTATTTTGATTT Andricus TTTATTTGTTTGATCAATTTTTTTAACAACTATTTTATTATTATTATCTTTACCTATTTTAGCTGGTGCAATTACTATATTATTATTTGATCGTAATATAAATACTTCATTTTTTGATCCTATAGGAGGAGGGGATCCAATTTTATACCAACATTTATTTTGATTT Neuroterus TTTATTTGTTTGATCTATTTTTTTAACTACAATTTTATTACTTTTATCTTTACCAATTTTAGCAGGAGCAATTACAATATTATTATTTGATCGAAATATAAATACCTCATTTTTTGATCCTATAGGAGGGGGGGATCCTATTTTATATCAACATTTATTTTGATTT Biorhiza TTTATTTGTATGATCAATTTTTTTAACTACAATTTTATTATTATTATCTTTACCAATTTTAGCCGGAGCAATTACAATATTATTATTTGATCGTAATATAAATACTTCTTTTTTTGACCCTATAGGAGGAGGAGACCCAATTTTATATCAACATTTATTTTGATTT Parnips TTTATTTATTTGATCTATTTTATTAACAACTATTTTACTTTTATTGTCATTACCTGTATTGGCTGGAGGGATTACTATATTATTGTTTGATCGGAATTTAAATACTTCATTTTTTGATCCTTTAGGAGGTGGGGACCCTGTTTTATATCAACATTTATTTTGATTT Paramblynotus ATTATTTATTTGATCTATTTATTTAACAACAATTTTATTATTATTATCTTTACCAGTTTTAGCAGGAGGAATTACAATATTATTATTTGATCGTAATTTAAATACTTCATTTTTTGATCCAATAGGTGGAGGAGATCCAATTCTTTACCAACATTTATTTTGGTTT Ibalia TTTATTTATTTGATCTATTTTATTGACTACAATTTTATTATTATTATCTTTACCTGTATTAGCAGGAGGAATTACAATATTATTGTTTGATCGTAATTTAAATACTTCATTTTTTGACCCCATAGGGGGAGGGGACCCTATTTTATACCAACATTTATTTTGATTT

Synergus TTTGGTCACCCCGAAGTATATATTTTAATTTTACCAGGTTTTGGAATAATTTCACATATAATTTACATAGAATCAGGAAAAAAAATAACTTTTGGATCTTTAGGAATAATATATGCAATAATTTCAATTGGAATTTTAGGATTTATTGTATGAGGGCATCATATAT Periclistus TTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAGTATCTCATATAATTTATACTGAGTGTGGTAAAAAAGGTACTTTTGGATCTTTAGGAATAATATATGCAATAATTTCAATTGGATTATTAGGATTTGTTGTTTGAGGGCATCATATAT Ceroptres TTTGGACATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCATATAATTTATTTAGAAACTGGAAAAAAAATTACTTTTGGATCTTTAGGAATAATTTATGCAATAATTTCTATTGGAATGTTAGGTTTTATTGTATGAGGACATCATATAT Synophromorpha TTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTTGTGTAGAATGTGGAAAAAAAAATACTTTTGGTTCATTAGGAATAATATATGCTATAATTTCTATTGGTATATTAGGATTTATTGTTTGAGGACATCATATAT Xestophanes TTTGGTCATCCTGAAGTTTATATTTTAATTTTACCGGGATTTGGTATAATTTCTCATATAATTTTTATAGAATGTGGAAAAAAAAATACTTTTGGTTCTTTAGGAATAATTTATGCTATAATTTCTATTGGAATATTAGGATTTATTGTTTGAGGGCATCATATAT Diastrophus TTTGGACACCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTTATACAGAATGTGGAAAAAAAATTACTTTTGGTTCTTTAGGAATAATATATGCAATAATTTCTATTGGAATATTAGGATTTATTGTATGAGGACATCATATAT Gonaspis TTTGGTCATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCATATAATTTATACAGAATGTGGAAAAAAAATTACTTTTGGATCTTTAGGTATAATATATGCTATAATTTCTATTGGAATATTAGGATTTATTGTTTGAGGTCATCATATAT Liposthenes_gle TTTGGTCATCCTGAAGTTTATATTTTAATTTTGCCCGGATTTGGAATAATTTCTCATATAATTTATTTAGAATGTGGGAAAAAAATTACATTTGGGTCTTTAGGTATAATATATGCAATAATTTCAATTGGAATATTAGGATTTATTGTATGGGGTCATCATATAT Liposthenes_ker TTTGGTCATCCTGAAGTTTATATTTTAATTCTTCCAGGATTTGGAATAGTCTCTCACTTAATTTATTCTGAATGTGGAAAAAAAAACACTTTTGGATCCTTAGGGATAACATATGCTATAATCTCTATTGGATTATTAGGATTTATTGTCTGAGGACATCATATAT Antistrophus TTTGGTCACCCAGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCCCATATAATTTATTCAGAATGTGGTAAAAAAACAACATTTGGTGTATTAGGAATAATTTATGCTTTAATTTCAATTGGTATATTAGGATTTATTGTATGAGGACATCATATAT Rhodus TTTGGTCACCCTGAAGTCTATATCTTAATTTTACCTGGATTTGGTATAATCTCTCATATAATTTATATAGAATGTGGAAAACCCACAACCTTTGGTTCATTAGGTATAATATACGCAATAATTTCAATTGGAATATTAGGATTTATCGTATGAGGACATCATATAT Hedickiana TTTGGTCACCCAGAAGTTTATATTTTAATTCTTCCAGGATTTGGAATAATTTCTCATATAATTTATTCAGAATGTGGTAAAAAAACAACATTTGGTTCATTAGGGATATTATATGCAATAATTTCTATTGGAATATTAGGTTTTATTGTTTGAGGCCATCATATAT Neaylax TTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTTTTTTAGAGTGTGGGAAAAAAACAACATTTGGGTCATTAGGAATAATATACGCCATAATTTCAATTGGAATACTAGGATTTATTGTATGAGGCCATCATATAT Isocolus TTTGGTCACCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTTATAGTGAGTGTGGGAAAAAAACTACATTTGGATCTTTAGGAATAATATATGCTATAATTTCAATTGGTGTTTTAGGGTTTCTTGTTTGAGGTCATCATATAT Aulacidea TTTGGTCATCCTGAGGTTTATATTTTAATTTTACCAGGATTTGGGATAATTTCACATATAATTTATATAGAATGTGGTAAAAGAATTACTTTTGGAGCTTTAGGGATAATATATGCAATAATTTCCATTGGAATATTAGGATTTATTGTTTGAGGCCATCACATAT Panteliella TTTTGTCACCCTGAAGTTTATATTCCAATTTTAGCTGGATTTGGGATAGTGTCTCATATAATTTATTTAGAATGTGGGGAAAAAATTACATTTGGGTCTTTAGGAATAATATACGCAATAATTTCAATTGGTATATTAGGTTTTATTGTATGAGGACATCATATAT Barbotinia TTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGGTTTGGAATAATTTCTCATATAATTTATAGAGAATGTGGAAAAAAAACTACTTTTGGATCATTAGGTATAATATATGCAATAATTTCAATTGGTTTACTAGGATTTATTGTTTGAGGTCATCATATAT Aylax TTTGGTCATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGTATAATTTCTCATATAATTTATAGTGAAAGAGGAAAAAAAACTACTTTTGGATCTTTAGGAATAATTTATGCTATAATTTCAATTGGATTATTAGGATTTATTGTATGAGGGCATCATATAT Iraella TTTGGTCATCCTGAAGTATATATTTTAATTTTACCAGGATTTGGGATAATTTCTCATATAATTTATAATGAATGTGGGAAAAAAACTACTTTTGGATCTTTAGGAATAATATATGCAATAATTTCTATTGGAATATTAGGATTTATTGTTTGAGGTCATCATATGT Timaspis TTTGGCCATCCAGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCACATATAATTTACACAGAATGTGGGAAAAAAATTACTTTTGGATCTTTAGGAATAATATATGCAATAATTTCTATTGGAATATTAGGGTTTATTGTATGAGGCCATCATATAT Phanacis_1 TTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATCTCTCATATAATTTATAATGAATGTGGTAAAAAAATTACTTTTGGATCATTAGGAATAATATACGCTATAATTTCAATTGGTATATTAGGATTTATTGTATGAGGTCACCATATAT Phanacis_2 TTTGGGCATCCTGAAGTGTATATTTTAATTCTTCCAGGATTTGGGATAGTGTCTCATATAATTTTTACTGAATGTGGACAAAAAACTACTTTTGGATCATTAGGGATAATATATGCTATAATTTCAATTGGAATATTAGGATTTATTGTTTGAGGTCATCATATAT Eschatocerus TTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTTTTACTGAATGTGGTAAAAAATCTACTTTTGGTTCTTTAGGAATATTATATGCTATAATTTCTATTGGAGCTTTAGGATTTATGGTTTGAGGTCATCATATAT Diplolepis TTTGGTCATCCAGAAGTTTATATTTTAATTTTGCCAGGATTTGGTATAATTTCTCATATAATTTATTCTGAATGTGGTAAAAAATTTACTTTTGGTTCATTAGGTATGATATATGCTATAATTTCAATTGGTATATTAGGGTTTATTGTATGAGGACATCATATAT Pediaspis TTTGGACACCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTACAAATGAATGTGGAAAAAAAACTACTTTTGGTTCTTTAGGAATAATATATGCTATAATTTCAATTGGTATATTAGGTTTTATTGTATGAGGACATCATATAT Plagiotrochus TTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGGTTTGGAATAATTTCTCATATAATTTATTTGGAATGTGGAAAAAAAAATACTTTTGGATCATTAGGAATAATATATGCTATAAATTCAATTGGTATATTAGGATTTATTGTATGAGGTCATCATATAT Andricus TTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGCTTTTGGTATAATTTCTCATATAATTTATATAGAATGTGGGAAAAAAAATACTTTTGGTTCATTAGGAATAATATATGCTATAATTTCAATTGGTATATTAGGATTTATTGTTTGGGGTCATCATATAT Neuroterus TTTGGGCATCCAGAAGTTTATATTTTAATTTTACCAGCATTTGGTATAATTTCACATATAATTTATATAGAATGTGGAAAAAAAAATACTTTTGGGTCTTTAGGAATAATATATGCAATAATTTCAATTGGTATATTAGGATTTATTGTTTGAGGTCATCATATAT Biorhiza TTTGGGCACCCAGAAGTTTATATTTTAATTTTACCTGCTTTTGGAATAGTTTCTCATATAATTTATATAGAATGTGGAAAAAAAAATACTTTTGGATCTTTGGGAATAATATATGCAATAATTTCAATTGGTATATTAGGATTTATTGTTTGAGGACATCATATAT Parnips TTTGGTCATCCAGAAGTATATATTTTAATTTTACCAGGATTTGGTATAATTTCCCATATAATTTATACAGAATGTGGAAAAAAAACTACATTTGGATCTTTAGGAATAATATATGCTATAATTTCTATTGGAATATTAGGGTTTATTGTTTGAGGCCATCATATAT Paramblynotus TTTGGCCATCCAGAAGTTTACATTTTAATTTTATCAGGATTTGGTATAATTTCTCATATGATTTATACTGAATGTGGGAAAAAAAATACTTTTGGTTCATTAGGAATAATTTATGCAATAATTTCTATTGGTATGTTAGGATTTATTGTTTGAGGTCATCATATAT Ibalia TTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTTATACAGAATGTGGTAAAAAAAGAACTTTTGGGGCATTAAGAATAATATATGCAATAATTTCTATTGGGATATTAGGATTTATCGTATGAGGACATCATATAT

Synergus TTACAGTAGGTATAGATGTAGATACTCGAGCTTATTACACATCTGCGACTATAATTATTGCTATCCCAACAGGTATTAAAATTTTTAGTTGATTAGCAACTATATATGGGTCAAAAATTAAATTTAATTTATCTATAATTTGATCTATAGGATTTATTTTTTTATT Periclistus TTACTATTGGTATAGATATTGACACGCGAGCTTATTATACTTCTGTAACAATAGTTATTGCTATTCCTACAGGAATAAAAATTTTTAGATGACTAGCAACAATATATGGTTCAAAAATTAATTGTAGGGTTCCTATATTTTGATCATTAGGTTTTATTTTTTTATT Ceroptres TTACAGTAGGAATAGATGTAGATACTCGAGCTTATTATACTTCAGCTACTATAATTATTGCAATTCCCACAGGAATCAAAATTTTTAGATGATTGGCTACAATATATGGATCAAAATTAGACATTAATATTTCAATAATATGATCTTTAGGATTTATTTTTTTATT Synophromorpha TTACTGTAGGAATAGATATTGATACACGAGCTTATTATACATCTGTAACTATAATTATTGCAATTCCYACGGGAATTAATATTTTTAGATGATTAGCTACAATATATGGATCAAAAATTAATTTTAATTTATCAATTATATGATCATTAGGTTTTATTTTTTTATT Xestophanes TTACTGTAGGAATAGATATTGATACACGAGCTTATTATACTTCTGTAACTATAATTATTGCAATTCCTACTGGAATTAAAATTTTTAGATGATTAGCTACAATATATGGATCAAAAATTAATTTTAATTTATCAATTAAATGATCATTAGGATTTATTTTTTTATT Diastrophus TTACTGTAGGGATAGATATTGATACACGAGCTTATTATACTTCAGTAACTATAATTATTGCTATTCCAACAGGAATTAAAATTTTTAGATGGTTAGCAACAATATATGGTACAAAAATTAATTTTAATCCTTCAATTATTTGATCATTAGGCTTTATTTTTTTATT Gonaspis TTACTGTAGGTATAGATATTGATACTCGAGCTTATTATACGTCAGTAACTATAATTATTGCAATTCCTACAGGGATTAAAATTTTTAGATGATTAGCTACTATATATGGATCAAAAATTAATTTTAATCCCTCAATTATTTGATCATTAGGCTTTATTTTTTTATT Liposthenes_gle TTACTGTAGGAATAGATGTAGATACACGGGCATACTACACTTCAGCTACAATAATTATTGCAGTCCCTACAGGTATTAAAATTTTTAGATGATTGGCAACAATATATGGGTCAAGAATTAATTTAAATTTATCAATTATATGATCTTTAGGGTTTATTTTTTTATT Liposthenes_ker TTACTGTAGGAATGGATGTCGACACCCGAGCTTATTATACTTCTGCAACTATAATTATTGCAATTCCACCAGGAATCAAAATTTTTAGATGATTAGCTACAATATATGGATCTAAAATTTACATAAATTTATCAATTTTATGATCCTTAGGATTTATTTTTCTATT Antistrophus TTACAGTTGGCATAGATGTAGATACACGAGCCTATTACACATCAGCAACTATAATTATTGCTATTCCTACAGGTATTAAAATTTTTAGTTGATTGGCAACAATATATGGAATAAAGATTAATTATAATTTATCAATAATTTGAGCTTTAGGATTTATCTTTTTATT Rhodus TTACTGTAGGAATAGATGTAGACACCCGAGCATATTACACATCCGCTACCATAATTATTGCAATTCCTACTGGAATTAAAATTTTTAGGTGATTAGCTACAATATACGGATCAAAAATTAATTTTAATTTATCCATTATATGATCCTTAGGATTTATTTTTTTATT Hedickiana TTACTGTGGGTATAGATGTAGATACACGAGCTTATTACACATCAGCAACTATAATTATTGCAGTTCCTACTGGTATTAAAGTATTTAGTTGATTGGCATCAATATATGGAGCAAAAGTTAATTTTAATTTATCAATTCTTTGATCATTAGGATTTATTTTTTTATT Neaylax TTACTGTTGGGATAGATGTTGATACACGTGCATATTATACTTCAGCAACAATAATTATTGCAATTCCTACTGGTATTAAAATTTTTAGATGATTAGCAACTATTTATGGAACAAAAATTAATTTTAATCCATCAATTATTTGATCTTTAGGGTTTATTTTTTTATT Isocolus TTACAGTAGGGATAGATGTAGATACACGAGCTTATTATACTTCAGTAACAATAATTATTGCAATCCCTACAAGTATTAAAATTTTTAGATGATTAGCTACTATACATGGTACAAAAATTAATTTTAACCTATCTATTTTATGATCTTTAGGATTTGTATTTTTATT Aulacidea TTACTGTAGGGATAGATGTTGATACACGAGCTTATTATACTTCAGCAACGATAGTAATTGCTATCCCTACAGGAATTAAAATTTTTAGGTGACTTGCAACTATATATGGATCTAAAATTAATTTTAATTTATCAATTATATGATCATTAGGTTTTATTTTTTTATT Panteliella TTACTGTTGGGATAGATGTAGATACACGAGCTTATTACACTTCAGCCACTATAATTATTGCAATTTCTACAGGAATTATAATTTTTAGATGATTAGCTACTATATATGGATCAAAGATTGATTTTAATTTATCTATATTATGATCTTTAGGATTTATTTTTTTATT Barbotinia TTACTGTTGGGATAGATGTAGATACACGAGCTTATTATACATCAGCAACAATGGTAATTGCTATTCCTACAGGAATTAAAATTTTTAGGTGATTAGCAACTATATATGGATCAAAAATTAATTTTAATTTATCAATAATTTGATCATTAGGATTTATTTTTTTATT Aylax TTACTGTTGGTATAGATGTAGATACTCGTGCTTATTATACTTCTGCTACAATAGTAATTGCTATCCCCACAGGAATTAAAATTTTTAGATGACTTGCTACTATATATGGATCAAAAATTGATTTTAATTTATCTATAATTTGATCATTAGGATTTATTTTTTTATT Iraella TTACTGTAGGAATAGATGTTGATACACGAGCTTATTACACTTCAGCAACAATAGTTATTGCAATTCCTACAGGTATTAAAATTTTTAGTTGATTAGCAACTATATATGGATCAAAAATTGATTTAAATTTATCAATAATTTGATCTTTAGGTTTCATTTTTTTATT Timaspis TTACTGTAGGCATAGATGTTGATACTCGAGCTTATTACACTTCTGCAACTATAATTATTGCTATTCCAACAGGTATTAAAATTTTTAGATGATTAGCAACAATATATGGATCAAAATTAAATTTTAGTTTATCTATAATTTGATCTTTAGGTTTTATTTTTTTATT Phanacis_1 TTACTGTAGGGATAGATGTAGACACCCGAGCTTATTACACATCAGCTACAATAATTATTGCTATCCCTACTGGGATTAAAATTTTTAGTTGGTTAGCAACAATATATGGGGCTAAAGTAGATTTTAATTTATCAATAATATGAGCTTTAGGGTTTATTTTTTTATT Phanacis_2 TTACTGTTGGAATAGATGTAGATACACGAGCTTATTACACTTCAGCAACAATAGTAATTGCTATCCCAACTGGTATTAAAATTTTTAGATGGTTAGCTACTATATATGGATCAAAAGTAGAATTTAACCCTTCAATTATATGGGCTTTAGGGTTTATTTTTTTATT Eschatocerus TTACAGTAGGTATAGATGTTGATACTCGAGCTTATTTTACTTCTGTAACTATAATTATTGCTATTCCTACTGGAATTAAAATTTTTAGATGATTAGCTACTATATATGGATCAAAAATAAAATTTAGATTACCTATATTATGATCTTTAGGATTTGTATTTTTATT Diplolepis TTACTGTTGGTATAGATATTGATACACGGGCTTATTATACATCAGTTACTATAATTATTGCTGTTCCTACAGGTATTAAAATTTTTAGGTGATTGGCTACTATATATGGAGCAAAAATTGATTATAATTTGGCTATAATTTGATCATTAGGATTTATTTTTTTATT Pediaspis TTACTGTAGGAATAGACATTGATACACGAGCTTATTATACATCAGCTACTATAATTATTGCAGTTCCAACAGGAATTAAAATTTTTAGATGATTAGCAACAATATATGGATCAAAAATTAAATTAAATATAATTATAATTTGATCTTTAGGTTTTATTTTTTTATT Plagiotrochus TAACTGTAGGCATAGATATTGATACACGAGCTTATTACACATCTGTAACTATAATTATTGCTATTCCTACAGGAATTAAAATTTTTAGATGATTAGCAACAATATATGGAACTAAAATAAATTTTAACTTATCAATTATATGAGCTCTAGGGTTTATCTTTTTATT Andricus TTACTGTAGGTATAGATATTGATACACGAGCTTATTATACATCAGTAACAATAATTATTGCTATTCCTACAGGAATTAAAATTTTTAGGTGGTTAGCAACTATATATGGATCAAAAATTAATTTTAATTTATCAATTATATGATCTTTAGGATTTATTTTTTTATT Neuroterus TTACTGTAGGAATAGATATTGACACACGAGCTTATTATACTTCAGTAACAATAATTATTGCGATTCCTACAGGAATTAAAATTTTTAGATGATTAGCTACAATATATGGATCAAAAATTAATTTTAATTTATCAATTATATGAGCTTTAGGGTTTATTTTTTTATT Biorhiza TTACTGTAGGGATAGATATTGATACACGAGCTTATTATACTTCAGTTACAATAATTATTGCAATTCCTACAGGTATTAAAATTTTTAGATGATTAGCTACTATATATGGGTCAAAAATTAATTTTAATTTATCTACTATATGAGCTTTAGGATTTATTTTTTTATT Parnips TTACGGTAGGTATAGATGTAGATACACGAGCTTATTATACTTCTGCTACTATGATTATTGCAGTTCCTACAGGAATTAAAATTTTTAGATGATTAGCAACAATATATGGATCAAAAATTAAATATAATTTATCAATAATATGAGCTATTGGATTTGTATTTTTATT Paramblynotus TTACTGTTGGAATAGATGATGATACCCGTGCCTATTATACTTCTGTAACTATAATTATTGCAATCCCAACTGGTATTAAAATTTTTAGATGATTAGCAACAATATATGGATCAAAAATTTTAATAAATTTATCAATAATTTGATCATTAGGATTTATTTTTTTATT Ibalia TTACTGTAGGGATAGATGTAGATACTCGAGCTTATTATACTTCTGTAACTATAATTATTGCTATCCCAACAGGAATTAAAATTTTTAGATGATTAGCTAGGATATATGGGTCTAAAATTAAATTTAATTTATCTATTATTTGATCAATTGGATTTATTTTTTTATT

Synergus TTCATTTGGAGGAATAACAGGAATTACTTTAGCAAATTCTTCGATTGATATTATAATACATGATACTTATTATGTAGTAGCCGATCGACATTGCTCTCTGGAAATTCGAAACCGCCAAGTACTACGTAACCATCATTGATGCACCAGGTCATCGTGATTTCATAAA Periclistus TTCATTTGGAGGATTAACAGGAATTACATTATCTAATTCTACTATTGATATTATATTACATGATACTTATTATGTAGTTGCNGATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTGACCATCATTGATGCACCAGGACATCGTGATTTCATCAA Ceroptres TTCAATAGGAGGAATAACAGGAGTAACTTTATCTAATTCTTCTATTGATATTATTTTGCATGATACTTATTATGTAGTAGCT???????????????????????????????????????????????????????????????????????????????????? Synophromorpha TTCAATTGGAGGAATAACAGGAGTAACTTTACCTAATTCTTCAATTGATATTATTTTACATGATACTTATTATGTAGTGGCTGATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTGACCATCATTGATGCACCAGGACATCGTGATTTCATCAA Xestophanes TTCAATTGGAGGAATAACAGGAGTAACTTTATCTAATTCTTCTATTGATATTATTTTACATGATACTTATTATGTAGTAGCTGATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTGACAATCATTGATGCACCAGGACATCGTGATTTCATCAA Diastrophus TTCAATTGGGGGAATAACAGGGGTAACTTTAGCTAATTCATCAATTGATATTATTTTACATGATACTTATTATGTAGTGGCTGATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTATGTGACTATCATTGATGCACCAGGACATCGTGATTTCATCAA Gonaspis TTCAATTGGGGGAATAACAGGAGTAACTTTATCTAATTCATCAATTGATATTATTTTACATGATACTTATTATGTAGTTGCTGATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTGACCATCATTGATGCACCAGGACATCGTGATTTCATCAG Liposthenes_gle TTCTATTGGTGGATTAACAGGTGTGACTCTTTCTAATTCATCGATTGATATTATTTTACATGACACTTATTATGTAGTGGCTTATCGACATTGCTCTGTGGAAATTTGAAACAGCCAAGTACTACGTGACCATCATTGATGCACCAGGACACCGTGATTTCATAAA Liposthenes_ker TTCTATTGGAGGAATTACTGGTATTACCTTAGCAAATTCTTCTCTAGACATTATCCTTCATGACACTTACTATGTTGTAGCATATTGACATTGCTCTGTGGAAATTTGAAACTGCCAAGTACTACGTGACCATCATTGATGCACCAGGACATCGTGATTTCATAAA Antistrophus TTCTTTTGGAGGATTAACAGGAATTACTTTATCAAATTCTTCAATTGATATTTCTTTACGTGATACATATTATGTAGTTGCTTATCGACATTGCTCTGTGGAAATTTGAAACTGCCAGGTACTACGTGACCATCATTGATGCTCCAGGACATCGTGATTTCATAAA Rhodus TTCTTTAGGAGGATTAACAGGGGTTACTTTAGCAAATTCTTCAATTGACATTATTTTACATGATACTTACTATGTAGTAGCCTATCGACATTGCTCTGTGGAAGTTTGAAACTGCCAAGTACTACGTGACCATAATTGATGCACCAGGACATCGTGATTTCATAAA Hedickiana TTCACTTGGAGGAGTGACAGGTGTTACTTTATCTAATTCATCAATTGATATTGTTATACATGATACTTATTATGTTGTTGCATATCGACATTGCTCTGTGGAAGTTTGAAACTGCCAAGTACTACGTGACCATAATTGATGCACCAGGACATCGTGATTTTATAAA Neaylax TTCAATTGGGGGGATGACAGGAGTTACACTATCTAATTCTTCAATTGATATTATTATACATGATACTTATTATGTCGTAGCTTATCGACATTGCTCTGTGGAAGTTTGAAACTGCCAAGTACTACGTGACCATAATTGATGCACCAGGACATCGTGATTTCATAAA Isocolus TTCATTAGGGGGGATAACAGGAGTAACATTAGCAAATTCATCTATTGACATTATTTTACATGATACTTATTATGTAGTTGCATATCGACATTGCTCTGTGGAAATTTGAAACTGCCAAGTACTACGTGACCATCATTGATGCACCAGGACATCGTGATTTCATAAA Aulacidea TTCTTTAGGTGGTTTGACAGGAGTCACATTATCAAATTCTTCACTTGATATTATTTTACATGATACTTATTATGTAGTGGCTTATCGACATTGCTCTGTGGAAATTTGAAACTGCCAAGTACTACGTGACCATCATTGATGCACCAGGACATCGTGATTTCATAAA Panteliella TTCAATTGGAGGATTAACTGGAGTAACTTTATCAAATTCATCAATTGATATTGTTATACATGACACTTATTATGTTGTGGCNTATCGACATTGCTCTGTGGAAATTTGAAACTGCCAAGTACTACGTAACCATCATTGATGCACCAGGGCATCGTGATTTCATAAA Barbotinia TTCTCTTGGAGGAATTACAGGAATTACTTTATCTAATTCTTCAATTGATGTTATTTTACATGATACATATTATGTCGTAGCNGATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTAACCATCATCGATGTACCAGGACATCGTGATTTCATCAA Aylax TTCAATTGGAGGTATTACAGGAGTAACCTTATCAAATTCTTCAATTGATATTGTTTTGCATGATACATATTATGTTGTAGCTGATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTAACCATCATCGATGCACCAGGACATCGTGATTTCATCAA Iraella TTCAGTTGGGGGAATTACAGGAGTAACTTTATCAAATTCATCTATTGATATTATTTTACATGATACTTATTATGTAGTGGCTGATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTAACCATCATCGATGCACCAGGACATCGTGATTTCATCAA Timaspis TTCTATAGGAGGATTAACTGGTGTAACATTATCAAATTCATCAATTGATTTAATATTACATGATACTTATTATGTTGTAGCTAATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTGACAATCATTGATGCACCAGGGCATCGTGATTTTATCAA Phanacis_1 TTCAATAGGGGGATTAACTGGAGTTACTTTATCAAATTCTTCTATTGATTTGATTTTACATGATACTTATTATGTAGTTGCTAATCGACATTGCTCTGTGGAAATTTGAAACTGCCAAGTATTACGTGACAATCATTGATGCACCAGGGCATCGTGATTTTATTAA Phanacis_2 TTCAGTAGGGGGTTTAACAGGAGTAACTTTGGCTAATTCTTCAATTGATTTAATTATACATGATACATATTATGTAGTGGCTAATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTATGTAACGATCATTGATGCACCAGGCCATCGTGATTTTATTAA Eschatocerus TACTCTTGGTGGTCTAACTGGAGTTACTTTATCAAATTCATCAATTGATATTATCTTACATGATACATATTATGTAGTAGCTAATCGATATTGCTCTCTGGAAATTTGAAACGGCGAAATATTATGTTACCATAATTGATGCACCAGGACATCGTGATTTCATCAA Diplolepis TTCTTTAGGAGGATTAACAGGAGTTTTATTATCTAATTCATCCATTGATATTATTTTACATGATACATATTATGTTGTTGCNCATTGATATCGCTCTTTGGAAATTCGAAACAGCCAAATATTACGTGACCATCATCGATGCACCAGGACATCGTGATTTTATAAA Pediaspis TTCAATTGGAGGAATAACAGGAGTAACTTTATCAAATTCATCAATTGATATTATTTTACATGATACATATTATGTTGTAGCTTATCGACATTGCCCTCTGGAAATTCGAGACAGCCAAGTATTACGTAACCATCATCGATGCACCAGGACATCGTGATTTCATNAA Plagiotrochus TTCAATTGGAGGTATAACAGGAGTAACATTAGCAAATTCTTCTATTGATATTATTATACATGATACATATTATGTTGTAGCNGATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTCACCATCATTGATGCACCAGGACATCGTGATTTCATCAA Andricus TTCTATTGGAGGAATAACTGGAGTTACATTAGCTAATTCATCTATTGATATTGTTATACATGATACTTATTATGTTGTTGCNAATCGACATTGCTCTCTGGAAATTTGAAACAGCGAAATATTACGTGACCATCATTGATGCACCAGGACATCGTGATTTCATCAA Neuroterus TTCAATTGGAGGAATAACAGGTGTAACATTAGCAAATTCATCAATTGATATTGTTATACATGATACTTATTATGTTGTTGCTAATCGACATCGCTCTCTGGAAATTTGAAACGGCGAAATATTATGTGACCATAATTGATGCACCAGGACATCGTGATTTTATCAA Biorhiza TTCTATTGGAGGAATAACTGGTGTAACATTAGCTAATTCATCAATTGATATTATTATACATGATACTTATTATGTTGTTGCTAATCGATATTGCTCTCTGGAAATTTGAAACGGCGAAATATTATGTTACCATAATTGATGCACCAGGACATCGTGATTTCATCAA Parnips TTCTATTGGAGGTATGACTGGAGTAACATTATCAAATTCTTCAATTGATATTATTTTACATGATACTTATTATGTAGTTGCTCATTGACATTGCTCTTTGGAAATTCGAAACAGCCAAGTATTACGTTACCATCATCGATGCACCAGGTCATCGTGATTTCATAAA Paramblynotus TTCAATAGGTGGAGTTACAGGAATTACTTTATCTAATTCTTCTATTGATGTAATTTTACATGATACTTACTATGTAGTAGCTCATAGACATCGCTCTCTGGAAATTCGAAACAGCCAAGTATTACGTAACCATCATCGATGCACCGGGACATCGTGATTTCATAAA Ibalia TTCTTTTGGGGGAATAACTGGAGTTACTTTATCAAACTCTTCTATTGACATTATTCTTCATGATACTTATTATGTAGTAGCNCATCGACATTGCTCTCTGGAAATTTGAAACAGCCAAATATTACGTAACCATTATCGATGCACCAGGACATCGTGATTTCATAAA

Synergus AAACATGATTACGGGAACGAGTCAAGCTGATTGTGCAGTGCTGATTGTAGCAGCTGGAATTGGTGAATTCGAAGCTGGAATTTCGAAAAATGGTCAGACTCGTGAACATGCTTTATTGGCTTTCACCCTGGGAGTGAAGCAATTGATTGTGGGAGTCAACAAGATG Periclistus AAACATGATCACTGGAACAAGTCAGGCTGACTGTGCAGTGCTGATCGTAGCTGCTGGAATTGGAGAATTTGAAGCTGGAATCTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACCTTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATG Ceroptres  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Synophromorpha AAACATGATCACTGGAACAAGTCAGGCTGACTGTGCTGTGCTGATCGTAGCAGCTGGAATTGGAGAATTTGAAGCCGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCATTATTGGCTTTCACCCTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATG Xestophanes AAACATGATCACTGGAACAAGTCAGGCTGACTGTGCTGTGCTGATCGTAGCAGCTGGAATTGGAGAATTTGAAGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATG Diastrophus AAACATGATCACTGGAACAAGTCAGGCTGACTGTGCAGTGCTGATCGTAGCTGCTGGAATTGGAGAATTTGAAGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACACTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATG Gonaspis AAACATGATCACTGGAACAAGTCAGGCTGACTGTGCAGTGCTGATCGTAGCTGCTGGAATTGGAGAATTTGAAGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACACTGGGAGTTAAGCAATTGATTGTGGGAGTCAATAAGATG Liposthenes_gle AAACATGATCACTGGTACGAGTCAAGCTGATTGTGCTGTGCTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCCAAAAATGGTCAAACTCGGGAGCATGCTTTATTGGCTTTCACCCTTGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATG Liposthenes_ker AAACATGATCACTGGTACGAGTCAAGCTGACTGTGCTGTGCTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATATCCAAAAATGGTCAAACTCGAGAACATGCTTTATTGGCTTTCACCCTCGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATG Antistrophus AAACATGATCACTGGTACGAGTCAAGCTGATTGTGCTGTGCTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCTAAAAATGGTCAAACTCGAGAGCATGCTTTATTGGCTTTCACCCTCGGAGTAAAGCAGTTGATTGTGGGAGTCAATAAGATG Rhodus AAACATGATCACTGGTACGAGTCAAGCTGATTGTGCTGTGTTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCCAAAAATGGTCAAACTCGAGAGCATGCTTTATTGGCTTTCACCCTCGGAGTAAAGCAGTTGATTGTGGGAGTCAATAAGATG Hedickiana AAACATGATCACTGGTACGAGTCAAGCTGATTGTGCTGTGCTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCCAAAAATGGTCAAACTCGAGAGCATGCTTTATTGGCTCTCACCCTTGGAGTAAAGCAGTTGATTGTGGGAGTCAATAAGATG Neaylax AAACATGATCACTGGTACGAGTCAAGCTGATTGTGCTGTACTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGGATTTCCAAAAATGGTCAAACTCGGGAGCATGCTTTATTAGCTTTCACCCTCGGTGTAAAGCAGTTGATTGTGGGAGTCAATAAGATG Isocolus AAACATGATCACTGGTACTAGTCAAGCTGATTGTGCTGTGCTGATTGTAGCAGCTGGAATTGGGGAATTCGAAGCTGGAATATCCAAAAATGGTCAAACTCGAGAGCATGCTTTATTAGCTTTCACCCTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATG Aulacidea GAACATGATTACTGGTACGAGTCAAGCTGATTGCGCTGTGCTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCAAAAAATGGTCAAACTCGAGAGCATGCTTTATTGGCTTTCACCCTCGGAGTGAAGCAATTGATTGTCGGAGTCAATAAGATG Panteliella AAACATGATCACTGGTACGAGTCAAGCTGATTGTGCTGTGCTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCCAAAAATGGTCAAACTCGAGAACATGCTTTATTGGCCTTCACCCTTGGAGTGAAGCAATTGATTGTGGGAGTTAATAAGATG Barbotinia AAATATGATCACTGGAACGAGTCAAGCTGATTGTGCAGTGCTGATTGTAGCGGCTGGAATTGGAGAATTCGAAGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAGTTGATTGTAGGGGTCAACAAGATG Aylax AAACATGATCACTGGAACGAGTCAAGCTGATTGTGCAGTACTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGTATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTTACTCTAGGAGTGAAGCAATTGATTGTAGGGGTCAACAAGATG Iraella AAACATGATCACTGGAACGAGTCAAGCTGATTGTGCAGTGCTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGTATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTAAAGCAATTGATTGTAGGGGTCAATAAGATG Timaspis AAACATGATCACTGGAACAAGTCAAGCTGACTGTGCAGTGCTAATCGTAGCAGCTGGAATTGGAGAATTTGAAGCTGGAATTTCAAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAACTGATTGTGGGTGTCAATAAGATG Phanacis_1 AAACATGATCACTGGAACAAGTCAAGCCGATTGTGCAGTGCTGATCGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCAAAAAATGGCCAAACTCGAGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAACTGATTGTAGGTGTCAATAAGATG Phanacis_2 AAACATGATCACTGGAACAAGTCAAGCTGACTGTGCAGTGCTGATCGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCCAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAACTGATTGTGGGTGTCAATAAGACG Eschatocerus AAACATGATCACTGGAACGAGTCAAGCTGATTGTGCTGTACTGATAGTAGCAGCTGGAATTGGAGAATTCGAGGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATG Diplolepis AAACATGATTACTGGAACAAGTCAAGCTGATTGTGCAGTGTTAATAGTAGCAGCTGGAATAGGAGAATTCGAAGCTGGAATTTCAAAAAATGGCCAAACTCGTGAACATGCTCTACTTGCTTTTACCTTGGGAGTAAAGCAATTGATTGTCGGAGTCAATAAAATG Pediaspis AAATATGATTACTGGGACGAGTCAAGCTGATTGTGCAGTTCTGATAGTAGCAGCTGGAATAGGAGAATTCGAAGCTGGAATTTCCAAAAATGGTCAAACTCGTGAACATGCTCTACTGGCCTTCACCTTGGGAGTGAAGCAATTGATCGTTGGAGTCAATAAGATG Plagiotrochus AAACATGATCACTGGAACGAGTCAAGCTGATTGTGCAGTGCTGATTGTGGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTCTCACTCTTGGAGTGAAGCAATTAATTGTAGGAGTTAATAAGATG Andricus AAACATGATCACTGGAACGAGTCAAGCTGATTGTGCTGTGCTGATCGTAGCAGCTGGAATTGGAGAATTCGAGGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATG Neuroterus AAACATGATCACTGGAACGAGTCAAGCTGATTGTGCTGTACTGATCGTAGCAGCTGGAATTGGAGAATTCGAGGCTGGGATTTCGAAAAATGGTCAAACTCGTGAGCATGCTTTATTGGCTTTCACTCTGGGAGTGAAACAATTGATTGTAGGAGTCAATAAGATG Biorhiza AAACATGATCACTGGAACGAGTCAAGCTGATTGTGCTGTACTGATAGTAGCAGCTGGAATTGGAGAATTCGAGGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATG Parnips AAACATGATCACTGGAACGAGTCAAGCTGATTGTGCAGTTTTAATAGTAGCAGCAGGAATTGGAGAATTCGAAGCTGGAATTTCAAAGAATGGTCAAACTCGTGAACATGCTCTTTTGGCTTTCACCCTAGGAGTGAAGCAATTGATCGTTGGAGTCAATAAGATG Paramblynotus GAACATGATTACTGGAACTAGTCAGGCTGACTGTGCAGTTTTGATAGTAGCTGCAGGAATTGGAGAATTCGAGGCTGGAATTTCAAAGAATGGCCAAACTCGTGAACATGCCCTTTTGGCGTTCACCTTAGGAGTGAAGCAATTGATTGTTGGAGTCAACAAGATG Ibalia AAACATGATCACTGGAACAAGTCAAGCTGATTGTGCAGTTTTGATAGTAGCAGCAGGAATTGGAGAATTCGAAGCAGGAATTTCAAAGAATGGTCAAACTCGTGAACATGCTCTTTTAGCTTTCACCCTGGGAGTGAAACAATTGATTGTTGGAGTCAACAAGATG

Synergus GATATGACTGATCCACCATATTCTGAGAGTCGATTCGAAGAAATAAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTACAATACCGCTTCAGTTGCATTTGTTCCAATTTCTTCTAGGTCCATTTATATGTGAGATGTACGGAATGTTTGGCTCCCTATTC Periclistus GATATGACTGATCCGCCATATTCTGAGACTCGATTTGAAGAAATCAAGAAAGAGGTGTCTTCATACATCAAGAAAATTGGTTACAATACTGCTTCGGTAGCATTTGTTCCAATTTCTTCTTGGTCCATTTATGTGTGAGATCTACGCAATGCTTGGCTCCCTATTC Ceroptres  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TCTTGGACCATTTATATGCGAGATTTACGCAATGCTTGGCTCCCTATTC Synophromorpha GATATGACTGATCCACCATATTCTGAGAGTCGATTTGAAGAAATCAAGAAAGAGGTGTCTTCATACATCAAGAAAATTGGTTACAATACTGCTTCGGTTGCATTTGTTCCAATTTCT????????????????????????????????????????????????? Xestophanes GATATGACTGATCCACCATATTCTGAGAGTCGATTTGAAGAAATCAAGAAAGAGGTGTCTTCATACATCAAGAAAATTGGTTACAATACTGCTTCGGTTGCATTTGTTCCAATTTCT????????????????????????????????????????????????? Diastrophus GGCATGACTGATCCACCATATTCTGAGAGTCGATTTGAAGAAATCAAGAAAGAGGTGTCTTCATACATCAAGAAAATTGGTTTCAATACTGCTTCGGTTGCATTTGTTCCAATTTCT????????????????????????????????????????????????? Gonaspis GACATGACTGATCCACCATATTCTGAGAGTCGATTTGAAGAAATCAAGAAAGAGGTGTCATCATACATCAAGAAAATTGGTTACAATACTGCTTCGGTTGCATTTGTTCCAATTTCT????????????????????????????????????????????????? Liposthenes_gle GATATGACTGATCCACCATACTCTGAGAGTCGATTCGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCGTCGGTTGCATTTGTTCCAATTTCTTCTTGGTCCATTTTTATGTGAAATATACGCAATGCTTGGCTCCCTATTT Liposthenes_ker GATATGACTGATCCACCATACTCTGAGAGTCGCTTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGCTATAATACTGCGTCGGTTGCATTTGTTCCAATTTCTTCTTGGCCCATTTTTATGTGAGATGTACGGAATGTTTGGTTCCCTATTC Antistrophus GATATGACTGATCCACCGTACTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAAGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCGTCAGTTGCATTTGTTCCAATTTCTTCTTGGTCCATTTTTATGTGAGATGTACGCAATGCTTGGCTCCCTATTC Rhodus GATATGACTGATCCACCATACTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCGTCGGTTGCATTTGTTCCAATTTCTTCTTGGTCCATTTTTATGTGAGATGTACGCAATGTTTGGCTCCCTATTT Hedickiana GATATGATTGATCCACCATACTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCGTCGGTTGCATTTGTTCCAATTTCTTCTTGGTCCATTTTTATGTGAGATGTACGGAATGTTTGGCTCCCTGTTT Neaylax GATATGACTGATCCACCATACTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCGTCGGTTGCATTTGTTCCAATTTCTTCTTGGTCCATTTTTATGTGAGATGTACGGAATGTTTGGCTCCCTATTA Isocolus GATATGACTGATCCACCATACTCCGACAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCGTCGGTTGCATTTGTTCCAATTTCTTCTTGGTCCGTTTTTATGTGAGATGTACGCAATGCTTGGCTCCCTATTC Aulacidea GATATGACTGATCCACCATACTCTGAGAGCCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCATCGGTTGCATTTGTTCCAATTTCTTCTTGGTCCATTTTTATGTGAGATGTACGGAATGTTYGGCTCCCTATTC Panteliella GATATGACTGATCCACCATACTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCGTCGGTTGCATTTGTTCCAATTTCTTCTTGGTCCATTTTTATGTGAGATGTACGGAATGTTTGGCTCCCTTTTC Barbotinia GATATGACTGATCCTCCATATTCTGAAAGTCGATTTGAAGAAATAAAGAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTACAATACTGCTTCGGTTGCATTTGTTCCAATTTCTTCTTGGTCCATTTATATGTGAGATATATGCAATGCTTGGCTCCCTATTT Aylax GATATGACTGATCCTCCATATTCTGAAAGTCGATTTGAAGAAATAAAGAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTACAATACTGCTTCGGTTGCATTTGTTCCAATTTCTTCTTGGTCCATTTATATGTGAGATGTACGGAATGTTTGGCTCTCTATTT Iraella GATATGACTGATCCTCCATATTCTGAAAGTCGATTTGAAGAAATTAAGAAAGAAGTTTCTTCATACATCAAGAAAATTGGTTACAATACTGCTTCGGTCGCATTTGTTCCAATTTCT????????????????????????????????????????????????? Timaspis GACATGGCTGATCCATCATATTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAAAAAATTGGATACAATACTGCTTCGGTTGCATTTGTACCAATTTCTTCTTGGTCCATTTTTATGTGAGATATATGCAATGCTTGGCTCCCTATTC Phanacis_1 GACATGACTGATCCACCATATTCTGAAAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAAAAAATTGGATACAATACTGCTTCGGTTGCATTTGTTCCAATTTCT????????????????????????????????????????????????? Phanacis_2 GACATGACTGACCCACCATATTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAAAAAATTGGATACAATACTGCTTCGGTTGCATTTGTTCCAATTTCT????????????????????????????????????????????????? Eschatocerus GATATGACTGATCCACCATATTCTGAGAGTCGATTTGAAGAAATAAAAAAAGAGGTTTCCTCATACATCAAGAAAATTGGTTACAATACTTCTTCGGTTGCATTTGTTCCAATTTCTATTTGGACCACTCTTCTGTCAAATATACGCATTGCTCGGCTCACTTTTT Diplolepis GATATGACTGACCCACCATATTCAGAGAGCCGATTTGAAGAAATCAAAAAAGAAGTTTCTTCATACATCAAGAAAATTGGTTACAATACAGCTTCAGTTGCATTTGTTCCCATTTCTNNNNGGTCCATTCTTGTGTGAGATATACGCTTTACTTGGTTCTCTATTT Pediaspis GATATGACTGACCCACCATATTCTGAAAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAAAAAATTGGTTACAATACAGCTTCGGTTGCATTTGTTCCCATTTCTGTTTGGGCCATTTATATGTGAGCTGTATGCATTGTTCGGTTCCCTATTC Plagiotrochus GATATGACTGATCCGCCATATTCTGAGAGTCGATTTGAAGAAATCAAGAAAGAGGTGTCTTCATACATAAAGAAAATTGGTTACAATACTGCCTCGGTTGCATTTGTTCCAATTTCAACATGGACCTTTTATGTGCGAGATGTACGCAATGTTTGGCTCCCTATTC Andricus GATATGACCGATCCACCATATTCTGAAAGTCGTTTTGAAGAAATCAAGAAAGAGGTTTCCTCATACATCAAGAAAATTGGTTACAATACTTCTTCGGTTGCATTTGTTCCAATTTCTTCTTGGTCCATTTATGTGTGAGATCTACGCAATGCTTGGCTCCCTATTC Neuroterus GATATGACCGATCCACCATATTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCCTCGTACATCAAGAAGATTGGTTACAATACTTCTTCGGTTGCATTTGTTCCAATTTCT????????????????????????????????????????????????? Biorhiza GATATGACTGATCCACCATATTCTGAGAGTCGATTTGAAGAAATAAAAAAAGAGGTTTCCTCATACATCAAGAAAATTGGTTACAATACTTCTTCGGTTGCATTTGTTCCAATTTCTTCTTGGTCCATTTATATGTGAGATCTACGCAATGCTTGGCTCCTTATTC Parnips GATATGACTGACCCACCATATTCTGAGAGCCGATTTGAGGAAATAAAAAAGGAAGTTTCTTCATACATCAAGAAAATTGGCTACAATACTGTTTCGGTTGCATTTGTTCCCATTTCTATTGGGGCCATTTATGTGTGAAATGTATGGACTAACTGGCTCTCTATTC Paramblynotus GACATGACTGATCCACCTTATTCTGAAAGTCGTTTTGAGGAGATCAAGAAAGAGGTTTCCTCATACATCAAGAAGATTGGCTACAATACAGCATCAGTTGCATTTGTACCAATTTCT????????????????????????????????????????????????? Ibalia GATATGACTGATCCACCATATTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTATCTTCATACATCAAGAAAATTGGCTACAATACTGCTTCAGTTGCATTTGTTCCCATTTCT?????????????????????????????????????????????????

Synergus GGATGTGGCTCTATTTGGACAATGTGTATGATTGCTTTCGACCGATACAACGTTATCGTAAAAGGTTTAGCTGGCAAGCCCTTAACTATCAGTGGTGCAATTCTGCGCATTGCTTTTCTCTGGATCTGGGCAGTAATTTGGACAGTTGCACCAATGATAGGATGGA Periclistus GGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTCGATCGATACAATGTTATCGTAAAGGGTCTGGCTGGCAAACCGCTATCTATCAGTGGTGCAATTCTGCGCATTGTTGGACTCTGGGTCTGGGCAGTAATTTGGACCATTGCACCAATGATAGGATGGA Ceroptres GGATGTGCCTCCATTTGGACGATGTGTATGATTGCTTTCGACCGATACAATGTCATCGTGAAAGGTTTAGCTGGAAAGCCGCTAACTATCAGTGGTGCAATTCTGCGTATTATTGGTCTCTGGGCCTGGGCAATAGTTTGGACCGTTGCCCCAATGTTAGGATGGA Synophromorpha  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Xestophanes  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Diastrophus  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Gonaspis  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Liposthenes_gle GGATGCGGCTCCATTTGGACAATGTGTATGATTGCTTTCGATCGATACAATGTTATCGTAAAGGGCTTAGCAGGCAAGCCCTTAACTATCACTGGTGCAATTCTGCGGATTGTTGGTCTCTGGGTTTGGGCAGTTGTTTGGACCATTGCACCAATGATAGGATGGA Liposthenes_ker GGATGCGGCTCCATTTGGACAATGTGTATGATTGCTTTCGATCGATATAATGTTATCGTAAAAGGCTTAGCAGGCAAGCCCTTAACTATCACTGGTGCAACTCTGCGGATTATTGGTCTCTGGGCTTGGGCAGTCGTTTGGACCATTGCACCAATGATAGGATGGA Antistrophus GGATGCGGCTCCATTTGGACAATGTGTATGATTGCTTTCGATCGATACAATGTTATTGTAAAAGGCTTAGCAGGCAAGCCCTTAACTATCACTGGTGCAATTCTGCGGATTGTTGGTCTCTGGGTTTGGGCAGTCGTTTGGACTATTGCACCAATGATAGGATGGA Rhodus GGATGCGGCTCCATTTGGACAATGTGTATGATTGCTTTCGATCGATACAATGTTATTGTAAAAGGCTTAGCAGGCAAGCCCTTAACTATCACTGGTGCAGTTCTGCGGATTGTTGGTCTCTGGGTTTGGGCAGTCGTTTGGACCATTGCACCAATGATAGGATGGA Hedickiana GGATGCGGCTCCATTTGGACAATGTGTATGATTGCTTTCGATCGATACAATGTTATTGTAAAAGGCTTAGCAGGCAAGCCCTTAACTATCACTGGTGCAATTCTGCGGATTGTTGGTCTATGGGTTTGGGCAGTCGTTTGGACCATTGCACCAATGATAGGATGGA Neaylax GGATGCGGCTCCATCTGGACAATGTGTATGATTGCTTTCGATCGATACAATGTTATTGTAAAAGGCTTAGCAGGCAAGACCTTAACTATCACTGGCGCAATTCTGCGGATTGTTGGTCTCTGGGTTTGGGCAGTCGTTTGGACCATTGCACCAATGATAGGATGGA Isocolus GGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTTGACCGATATAATGTTATCGTAAAAGGTTTAGCTGGCAAGCCCTTGACTATCACTGGTGCAATTCTGCGGATTGTTGGTCTCTGGATTTGGGCAGTCGTTTGGACCATTGCACCAATGATAGGATGGA Aulacidea GGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTTGACCGATATAATGTTATCGTAAAAGGCTTAGCTGGCAAGCCCTTAACTATCACTGGTGCAATTCTGCGGATTGTTGGTCTCTGGGTTTGGGCAGTTGTTTGGACCATTGCACCAATGATAGGATGGA Panteliella GGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTCGACCGATACAATGTTATCGTAAAAGGCTTGGCTGGCAAGCCCTTAACTATCACTGGTGCAATTCTGCGGATTGTTGGTCTCTGGGTTTGGGCAGTCATTTGGACCATTGCCCCAATGATAGGATGGA Barbotinia GGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTCGACCGATACAATGTTATCGTAAAAGGTTTAGCTGGCAAGCCATTAACTATCAGTGGTGCAATTCTGCGTATTGTTTTTCTCTGGGTCTGGGCGGTAGTTTGGACCATTGCACCAATGATAGGATGGA Aylax GGATGTGGATCCATTTGGACAATGAGTATGATTGCTTTCGACCGATACAATGTTATCGTAAAAGGTTTAGCTGGCAAGCCATTAACTATCAGTGGTGCAATTCTGCGTATTGNTTTCCTCTGGCTCTGGGCGGTAATTNGGACCATTGCACCAATGATAGGATGGA Iraella  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Timaspis GGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTTGATCGATACAATGTTATTGTAAAAGGTTTAGCTGGCAAGCCATTAACTATCAGTGGTGCAATTCTACGCATTGTTGGTCTCTGGGTCTGGGCTGTCATTTGGACCATTGCACCAATGCTAGGATGGA Phanacis_1  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Phanacis_2  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Eschatocerus GGCTGTGCTTCAATCTGGACAATGTGTTTGATTGCCTTCGACAGGTACAATGTCATTGTCAAGGGTCTAGCTGGAAAACCTTTGACCATAACCGGTGCAGTCTTGCGTATATTTGCTCTCTGGATCTGGGCATTGATTTGGACAGTTGCACCAATGTTTGGATGGA Diplolepis GGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTTGATAGGTACAATGTAATAGTGAAAGGTTTGGCTGGGAAGCCCTTAACAATCACCGGTGCAATTATACGCATAATTGGCCTTTGGGTCTGGGCCATTATTTGGACTATTGCGCCAATGTTTGGATGGA Pediaspis GGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTCGACAGATACAACGTAATCGTAAAAGGCTTAGCTGGAAAGCCCTTAACCATAAGCGGTGCAATTATTCGTATAATTGGTCTCTGGGTCTGGGCCGTGATTTGGACCGTTGCACCAATATTTGGATGGA Plagiotrochus GGATGCGGCTCCATTTGGACGATGTGTATGATAGCTTTCGACCGATACAATGTTATCGTGAAGGGATTAGCTGGAAAGCCGTTAACTATCAGTGGTGCAATTCTGCGCATTGTTGGACTCTGGGTTTGGGCAGTAATTTGGACAATTGCACCAATGTTAGGATGGA Andricus GGATGTGTCTCCATTTGGACAATGTGTATGATTGCTTTTGATCGATACAATGTCATTGTAAAGGGTTTAGCTGGCAAGCCACTAACTATCAGTGGTGCAATTCTGCGCATTGTTGGTCTCTGGGTCTGGGCAATAATTTGGACCATTGCACCAATGTTGGGCTGGA Neuroterus  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Biorhiza GGATGTGCCTCCATTTGGACAATGTGTATGATTGCTTTCGACCGATACAATGTCATTGTAAAGGGTTTAGCTGGAAAGCCACTCACTATCAGTGGTGCAATTCTGCGTATTGCTGGTCTCTGGGTATGGGCAGTAATTTGGACCATTGCACCAATGTTGGGCTGGA Parnips GGATGTGGGTCCATTTGGACAATGTGCATGATTGCGTTCGACAGATACAACGTAATAGTAAAAGGTTTGGCAGGAAAACCTTTAACCATCAGTGGTGCAATTCTTCGCATAGTTGGTCTCTGGGTCTGGGCCGTTATTTGGACCATTGCACCAATGATAGGATGGA Paramblynotus  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Ibalia  ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????

Synergus ATCGGTACGTTCCGGAGGGTAACATGACAGCTTGCGGAACTGACTACCTGACTAAGGATTGGTTATCGAGGTCTTACATCATTGTATACAGCGTCTTCGTATACTTCATGCCACTTTTCCTCATCATATACAGTTACTATTTCATCATTGCTGCTGTATCTGCCCA Periclistus ATCGGTATGTTCCTGAAGGCAATTTGACAGCTTGCGGAACTGACTATCTGAGTAAGGATTGGTTGTCGAGGTCTTACATTCTTGTATACAGCGTCTTCGTATACTTCATGCCACTTTTCCTCATCATATACAGTTACTATTTCATCATCGCTGCTGTATCTGCTCA Ceroptres ATCGGTACGTTCCCGAAGGCAACATGACAGCTTGTGGAACTGACTATCTGACTAAGGATTGGTTCTCGAGATCTTACATTATTATATATAGCGTCTTCGTATACTTTGCGCCACTTTTCCTCATCATATACAGTTACTATTTCATCATTGCTGCTGTATCTGCTCA Synophromorpha  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Xestophanes  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Diastrophus  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Gonaspis  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Liposthenes_gle ATCGGTACGTTCCCGAGGGTAACATGACAGCTTGTGGAACTGATTATCTAACCAAAGATTGGTTCTCAAGGTCTTATATACTTATATACAGTGTCTTTGTATACTTCATGCCACTTTTTCTCATCATATACAGCTACTATTTTATCATTGCTGCTGTATCTGCTCA Liposthenes_ker ATCGGTACGTTCCCGAGGGTAACATGACAGCTTGTGGAACTGACTATCTAACCAAAGATTGGTTCTCGAGGTCTTATATACTTATATACAGYGTCTTTGTATACTTCATGCCACTTTTTCTCATCATATACAGCTACTATTTTATCATTGCTGCTGTATCTGCTCA Antistrophus ATCGGTACGTTCCCGAAGGTAACATGACAGCTTGTGGAACTGACTATCTAACTAAAGATTGGTTCTCGAGGTCTTATATAATTATATACAGTGTCTTCGTATACTTCATGCCACTTTTTCTCATCATATACAGTTACTATTTTATCATTGCTGCTGTATCTGCTCA Rhodus ATCGGTACGTTCCCGAAGGCAATATGACAGCTTGTGGAACTGACTATCTAACTAAAGACTGGTTCTCGAGGTCTTATATACTTATATACAGTGTCTTCGTATACTTCATGCCACTTTTTCTCATTATATACAGCTACTATTTTATCATTGCTGCTGTATCTGCTCA Hedickiana ATCGGTACGTTCCCGAAGGCAACATGACAGCTTGTGGAACTGACTATCTAACTAAAGACTGGTTCTCGAGGTCTTATATACTTATATACAGTGTCTTCGTATACTTTATGCCACTTTTTCTCATCATATACAGCTACTATTTTATCATTGCTGCTGTATCTGCTCA Neaylax ATCGGTACGTTCCCGAAGGCAACATGACAGCTTGTGGAACTGACTATCTAACTAAAGACTGGTTCTCGAGGTCTTATATACTTATATACAGTGTCTTCGTATACTTCATGCCACTTTTTCTCATCATATACAGCTACTATTTTATCATTGCTGCTGTATCTGCTCA Isocolus ATCGGTACGTTCCCGAGGGCAACATGACAGCTTGTGGAACTGACTACTTGACTAAGGATTGGTTCTCGAGGTCCTATATACTTATATACAGTGTCTTCGTATATTTCATGCCACTTTTTCTCATCATATACAGCTACTATTTCATCATTGCTGCTGTATCTGCTCA Aulacidea ATCGGTATGTTCCCGAGGGTAACATGACAGCTTGTGGAACTGACTATCTAACTAAGGATTGGTTCTCCAGGTCCTTCATACTTGTATACAGTATCTTCGTATACTTCATGCCACTTTTTCTCATCATATACAGCTACTATTTCATCATTGCTGCTGTATCTGCTCA Panteliella ATCGGTACGTTCCCGAGGGCAATATGACAGCTTGTGGAACTGACTATCTGAATAAAGATTGGTTCTCGAGGTCTTATATACTTATATACAGTGTCTTTGTATACTTTATGCCACTTTTTCTCATTATATACAGTTACTATTTCATCATTGCTGCTGTATCTGCCCA Barbotinia ATCGGTACGTTCCCGAGGGCAACATGACAGCTTGTGGAACTGACTATCTAACTAAGGATTGGTTCTCGAGGTCTTACATTCTTGTATACAGCGTCTTCGTATACTTCATGCCACTTTTCCTCATCATCTACAGTTACTATTTCATCATTGCTGCTGTATCTGCTCA Aylax ATCGGTACGTNCCCGAGGGTAACATGACAGCTTGTGGAACTGACTATCTANCTAAGGATTGGTTCTCGAGGT---------------------------------------------------------------------------------------------- Iraella  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Timaspis ATCGGTATGTTCCTGAAGGTAACATGACAGCTTGTGGGACTGACTATTTGACTAAGAACTGGTTCTCGAGGTCTTACATCCTTATATACAGCATTTTCGTGTATTTCATGCCACTTTTCCTCATAATATACAGTTACTATTTCATCATTGCTGCTGCATCTGCTCA Phanacis_1  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Phanacis_2  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Eschatocerus ATCGGTATGTACCTGAAGGTAATCTGACAGCATGTGGTACTGATTATTTGAGCAAGGACTGGCTCTCAAGATCCTACCTCCTCGTATATGGTTTCTTCGTATACTTCATGCCGCTTTTCCTGATCATCTATAGCTATTATTTTATAATCGCAGCCGTATCTGCCCA Diplolepis ATCGGTATGTACCTGAAGGTAACATGACAGCTTGCGGAACTGATTATTTAAGTAAAGACTGGTTCTCGAGGTCTTACATCCTTGTATACAGTATCTTCGTATACTATATGCCGCTTTTCCTTATCATATACAGTTACTATTTTATCATCTCAGCTGTATCTGCTCA Pediaspis ATCGGTATGTACCCGAGGGTAACATGACAGCTTGCGGAACTGACTATCTCAGTAAGGACTGGTTTTCGAGGTCTTACATCATTGTTTACAGTATCTTCGTGTACTACATGCCACTTTTCCTCATCATATACAGCTACTACTTTATCATCTCAGCTGTATCTGCTCA Plagiotrochus ATCGGTACGTTCCCGAGGGCAACATGACAGCTTGTGGAACTGACTATTTGACTAAGGATTGGTTCTCGAGGTCTTACATACTTGTATATAGCGTCTTTGTATACTTCATGCCACTTTTCCTTATCATATACAGTTACTATTTCATCATTGCTGCTGTAACAGCTCA Andricus ATCGGTATGTTCCCGAGGGCAACATGACAGCATGTGGAACTGACTATCTGTCTAAGGATTGGTTCTCGAGGTCTTACATTATTGTATACAGCATCTTTGTATACTTTATGCCACTTTTCCTCATCATATACAGTTACTATTTTATCATTGCTGCTGTAACTGCTCA Neuroterus  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Biorhiza ATCGGTATGTTCCTGAGGGCAACATGACAGCATGTGGAACTGACTATCTGTCTAAGGATTGGTTCTCAAGGTCTTACATTCTTGTATACAGCATCTTTGTATACTTTATGCCACTTTTCCTTATAATATACAGTTACTATTTCATCATTGCTGCTGTAACTGCTCA Parnips ATCGGTACGTACCCGAAGGTAACTTGACAGCTTGTGGAACTGACTATCTGACACAGGATTGGTTCTCCAAGTCTTATATCCTTGTATACAGTGTTTTCGTATATTTCATGCCACTTTTCCTCATCATATACAGCTATTATTTCATCATCGCAGCTGTATCTGCTCA Paramblynotus  ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Ibalia  ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????

Synergus TGAAAAGGCTATGCGTGAACAGGCCAAAAAGATGAATGTAGCTTCTCTACGATCATCTGACAATCAAAATACGAGTGCTGAACATAAACTTGCCAAGGTACTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-ACCCACGAGACCGATAGCGAACAAGTA Periclistus CGAAAAAGCAATGCGTGAACAGGCCAAAAAGATGAATGTAGCTTCTCTACGATCATCCGATAATCAAAATACGAGTGCTGAACATAAACTCGCCAAGGTA------------------------------------------------------------AAGGTA Ceroptres CGAAAAAGCAATGCGTGAACAGGCCAAAAAGATGAATGTAGCATCGCTACGATCATCCGACAATCAAAATACGAGCGCTGAACATAAACTCGCCAAGGTACTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTA Synophromorpha  ????????????????????????????????????????????????????????????????????????????????????????????????????CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTA Xestophanes  ????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------------------------ACCGATAGCGAACAAGTA Diastrophus  ????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------------------------ACCGATNGCGAACAAGTA Gonaspis  ????????????????????????????????????????????????????????????????????????????????????????????????????CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-GACCACGAGACCGATAGCGAACAAGTA Liposthenes_gle CGAAAAAGCAATGCGTGAACAAGCCAAAAAGATGAATGTAGCTTCTCTCCGATCCTCCGACAACCAAAATACGAGTGCTGAACATAAGCTCGCAAAGGTACTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTA Liposthenes_ker CGAAAAAGCAATGCGTGAACAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCCGACAACCAAAATACGAGTGCTGAACATAAGCTCGCAAAGGTACTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTA Antistrophus CGAAAAAGCAATGCGTGAACAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCCGATAACCAAAATACGAGTGCTGAACATAAGCTCGCAAAGGTACTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTA Rhodus CGAAAAAGCAATGCGTGAACAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCCGACAACCAAAATACGAGTGCTGAACATAAGCTCGCAAAGGTA---------------------------------------------ACCACTAGCGAN---CAAGTA Hedickiana CGAAAAAGCAATGCGTGAACAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCCGATAACCAAAATACG---------------------------CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTA Neaylax CGAAAAAGCAATGCGTGAACAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCCGACAACCAAAATACGAGTGCTGAACATAAGCTCGCAAAGGTACTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTA Isocolus CGAAAAAGCAATGCGTGAGCAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCCGACAATCAAAACACGAGTGCTGAACATAAGCTCGCAAAAGTA---------------------------------AATATGACNCACGAGACCGATAGCGAACAAGTA Aulacidea CGAAAAAGCAATGCGTGAGCAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCTGACAACCAAAACACGAGTGCTGAACATAAGCTGGCAAAGGTA---------------------------------------------ACAACTGGCGCTG--AAGNTA Panteliella CGAAAAAGCAATGCGTGAACAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCCGACAACCAAAATACGAGTGCAGAACATAAGCTCGCAAAGGTT-------------------------------GAGATATCAACCACGAGACCGATAGCGAACAAGTA Barbotinia TGAAAAAGCTATGCGTGAACAGGCCAAAAAGAWGAATGTAGCTTCTCTACGATCATCCGACAATCAAAATACGAGTGCTGAACATAAACTCGCCAAGGCA------------------------------------------CACGAGACCGATAGCGAACAAGTA Aylax ----------------------------------------------------------------------------------------------------CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAT-AACCACGAGACCGATAGCGAACAAGTA Iraella  ????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------------------------------------CAAGTA Timaspis CGAAAAAGCAATGCGTGAACAAGCAAAAAAGATGAATGTAGCTTCTCTACGATCGTCCGATAATCAGAATACGAGTGCTGAGCATAAGCTCGCAAAGGTA------------------------------------------------ACCGATAGCGAACAAGTA Phanacis_1  ????????????????????????????????????????????????????????????????????????????????????????????????????CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTA Phanacis_2  ????????????????????????????????????????????????????????????????????????????????????????????????????-------------------------------------------------CCGATAGCGAACAAGTA Eschatocerus TGAGAAAGCCATGCGAGAACAGGCCAAAAAGATGAATGTAGCTTCCCTGAGATCATCAGATAATCAGAATACAAGCACTGAACACAAACTTGCAAAAGTACTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAT-AACCACGAGACCGATAGCGAACAAGTA Diplolepis CGAAAAAGCAATGCGCGAACAGGCCAAAAAGATGAACGTAGCTTCTCTACGTTCATCTGACAATGCAAACACAAGTGCTGAGCATAAACTCGCAAAGGTA----------------------------------ATAT-AACCACGAGACCGATAGCGAACAAGTA Pediaspis CGAAAAAGCAATGCGTGAACAGGCCAAAAAGATGAACGTAGCTTCTCTACGATCATCAGACAATGCAAATACGAGTGCAGAGCATAAACTCGCAAAAGTA----------------------------------ATAT-AACCACGAGACCGATAGCGAACAAGTA Plagiotrochus TGAAAAAGCAATGCGTGAGCAGGCCAAAAAGATGAATGTGGCTTCCTTACGATCATCGGACAATCAAAATACAAGTGCTGAACATAAACTTGCCAAGGTA--------------------------------------GGTAAACCGAACTGGCGCTG--TTGGCG Andricus CGAAAAAGCAATGCGCGAACAGGCCAAAAAGATGAACGTGGCTTCCCTACGATCATCTGACAATCAAAATACGAGTGCCGAACACAAGCTCGCTAAGGTT-----------------------------------ATACAACCACGAGACCGATAGCGAACAAGTA Neuroterus  ????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------------------CACGAGACCGATAGCGAACAAGTA Biorhiza CGAAAAAGCAATGCGTGAACAGGCCAAAAAAATGAACGTCGCTTCCCTTCGATCATCCGACAATCAAAATACGAGTGCTGAGCATAAGCTCGCCAAGGTT----------------------------------------------AGACCGATAGCGAACAAGTA Parnips CGAAAAAGCTATGCGTGAACAGGCCAAAAAGATGAACGTAGCTTCTCTACGATCATCCGATAATCAAAATTCAAGTGCTGAACATAAGCTCGCGAAGGTA--------------------------------------------------CNATAGCGAACAAGTA Paramblynotus  ????????????????????????????????????????????????????????????????????????????????????????????????????CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-ACCCACGAGACCGATAGCGAACAAGTA Ibalia  ????????????????????????????????????????????????????????????????????????????????????????????????????------------------------CTAANGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTA

Synergus CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCTAAAAGATCGAATGGGGAGATTCATCGTCAGCGACTTTGGCTTTCGTGTGGTGC-GTGATGCT--CGAGATTTC----GGTCTCGC Periclistus CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGACTTTGGCTTTCGTGTGTGTC-GCGATGTT--CGGGGCTTC----GGTCTCGC Ceroptres CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCCTTGGCTTTCGTGTGGTTT-GCGATGTT--CGGGGCTTC----GGTCTCGC Synophromorpha CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGACTCTGGCTTTCGTGTGGTTC-GCGATGTT--CGGGGCTTC----GGTCTCGC Xestophanes CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGACTCTGGCTTTCGTGTGGTTC-GCGATGTT--CGGGACTTT----GGTCTTGC Diastrophus CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGACTCTGGCTTGCGTGTGGTTC-GCGATGCT--CGGGACTTC----GGTCTCGC Gonaspis CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGACTCTGGCTTGCGTGTGGTTT-GCGATGCT--CGGGGCTTC----GGTCTCGT Liposthenes_gle CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GCGATGTT--CGAGATTCC----GATCTCGT Liposthenes_ker CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCACCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GCGATGTT--CGAGACTTC----GGTCTCGC Antistrophus CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GTGATGCT--CGAGATTTT----TGTCTCGT Rhodus CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGATTC-GCGATGCT--TGAGATTTC----GGTCTCGT Hedickiana CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GCGATGCT--CGGGATTTC----GGTCTCGT Neaylax CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GCGATGCT--CGGGATTTC----GGTCTCGT Isocolus CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GCGATGTT--CGGGATTTC----GGTCTCGC Aulacidea CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTAT-GCGATGTT--CGGGATTTC----GGTCTCGT Panteliella CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GCGATGTT--CGGGATTTC----GATCTCGT Barbotinia CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAACGGCTTTGGCTTTCGTGTGGTTC-GCGATGTT--CGGGACTTC----GGTCTCGC Aylax CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAACGGCTTTGGCTTTCGTGTGGTTC-GCGATGTT--CGGGTCTTC----GGTCTCGC Iraella CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAACGGCTTTGGCTTTCGTGTGGTTC-GCGATGTT--CGGGACTTC----GGTCTCGC Timaspis CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGAGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GTGATGTT--CATGACTTC----GGTCTTGT Phanacis_1 CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GTGATGTT--CAAGACTTC----GGTTTTGC Phanacis_2 CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GTGATGTT--CGTGACTTT----GGTCTTGC Eschatocerus CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGAGGAGATTCATCGTCAATGTTTTTGGCTTTCCTGTGATTTAGTGATGTTT-TATAATCTTTTTAGATTATAT Diplolepis CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGGTCGAATGG-GAGACTCATCGTCAATAACTTTGGCTTTCGTGTGATTA-GTGATGTT--CGTAATTTC----GATTACGT Pediaspis CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCATTGGCTTTCGTGTGGTTC-ACGATGTTTGCAGGACCCTCGCGGGTCTTGT Plagiotrochus C-GTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTAC-GCGATGCGA-TGGGATTTC----GGTCACAT Andricus CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-ACGATGTT--CGAGACTTT----GGTCTTG- Neuroterus CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-ACGATGTT--CGAGACTTT----GGTCTTG- Biorhiza CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTCTGGCTTTCGTGTGGTTC-ACGATGTT--TGAGACTTT----GGTCTTA- Parnips CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GCGATGCT--CGTGACTTCT---GGTCACGT Paramblynotus CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAATCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTTTGTGATGTT--CGAGACCTC----GGTCCTGT Ibalia CCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTTTGTGATGTTT-CGGGATTTC----GGTCTCGT

Synergus GG--TACACGTCCACTGCGTT-ATGTCTAGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GCG-GTTGCCTGTTCTATTGCAT---TTAT--GTATATGGAGCAGACCCCCGGTT--ACCTGAC Periclistus AG--CACGCGTCCACTGCGGT-ATGTCTAGGGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTTACGACCCGTTAGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTTCGTTGCAC--TTTGT--GCGTACGGAGCAGACCCCCGGTA--ACCTGAC Ceroptres GA--CACGCGTCCACTGCGGT-ATGTTCTTGGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGCCTGGTGTG-GTTGCCTGTTTCGTCGCACAATTTATTTGTGCACGGAGCAGACCCCCGGAT--ACCCGAC Synophromorpha AG--CACGCGTCCACTGCGGT-ATGTCTAGGGCC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTTACGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGACTGTTTCGTCGCAC--TCTGTGCGTGTACGGAGCAGACCCCCGATC--ACCTGAC Xestophanes AG--CACGCGTCCACTGCGGTTATGTCTAGGGAC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTTACGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGACTGTTTCGTCGCAC--TTTGTGCGTGTACGGAGCAGGCCCCCGGTC--ACCTGAC Diastrophus AG--CACGCGTCCACTGCGGT-ATGTCTAGGGCC-GTCGGCGTGCACTTCTCCTCTAGTAGGACGTTACGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGCTTTGTCGCAC--TCTGT--GTGTACGGAGTAGACCCCCGGTT--ACCTAAC Gonaspis AG--CACGCGTCCACTGCGGT-ATGTCTAGGGCC-GTCGGCGTGCACTTCTCCTCTAGTAGGACGTTACGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTTCGTCACAC--TCTGT--GTGTACGGAGTAGACCCCCGGTT--ACCTAAC Liposthenes_gle AG--CACACGTCCACTGCGTT-ATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-ATG-GTTGCCTGTTCCGTTGCAT--TT-ATGCGC--ACGGGACAGACCTCCGGTT--ACCTGAC Liposthenes_ker AG--CACGCGTCCACTGCGTT-ATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTCCGTCGCAT--TT-ATGCGC--ACGGGGCAGACCCCCGGTT--ACCTGAC Antistrophus AG--CACATGTCCACTGCGTT-ATGTCTGGAGTC-GTCGGTGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTTCGTCGCAT--TT-ATGCGT--ACGGTTCAGACCCCCGGGTT-TCCTGAC Rhodus AG--CACACGTCCACTGCGTTTATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTTTTACGGTCTGG-GTGTGTTGCCTGTTCCGTCGTAT--TTTATACGC--ACGGGGCAGACCCCCGGTT--TCCTGAC Hedickiana AG--CACGCGTCCACTGCGTT-ATGTCTGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTCCGTCGTAT--TT-ATGCGT--ACGGAGCAGACCCCCGG-TA-TCCTGAC Neaylax AG--CACGCGTCCACTGCGTT-ATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTCCGTCGTAT--TT-ATGCGC--ACGGAGCAGACCCCCGG-TT-TCCTGAC Isocolus AG--CACACGTCCACTGCGTT-ATGTCTGAAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTAGG-TGTTGGTCT--ACGGTCTGG-GTG-GTTGCCTGTACCGTCACAT--TT-ATGCGC--ACGGGACAGACCCCCAGATTTACCTGAC Aulacidea AG--CACGCGTCCACTGCGGT-ATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTAG-GTG-GTTGCCTGTTCCGTCACAT--TT-ATGCGT--ACGGTGCAGACCCCTGGCT--ACCTGAC Panteliella AG--CACGCGACCACTGCGTT-ATGTCTGGAGTC-GTCGGCGTGCACTTCTCCTCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTCT--ACGGTCTGG-GTG-GTTGCCTGTTCCGTCGCAT--TT-ATGCGC--ACGGGGCAGACCCCTGGGT--ACCTGAC Barbotinia AG--CACGCGTCCACTGCGGT-ATGTCTGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTCCGTCGCAT--TTTATGCGT--ACGGAGCAGACCCCTGGTA--ACCCGAC Aylax AG--CACGCGTCCACTGCGGT-ATGTCTGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTTCGTCGCAT--TTTATGCGT--ACGGAGCAGACCCCTGGTA--ACCCGAC Iraella AG--CACGCGTCCACTGCGGT-ATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTAG-GTG-GTTGCCTGTTCCGTCACAT--TTTATGCGT--ACGGAGCAGACCCCTGGTA--ACCCGAC Timaspis AG--CACACGTCCACTGCGGT-ATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGAACGTCGTGACCCGTTGGA-TGTTGGTTT--ACGGTC-TGGGTG-GTTGCCTGTTCCATTGCAT---TTATGCGC--ATGGAGCATACCCCTGGTT--ACCTGAC Phanacis_1 AG--CACACGTCCACTGCGGT-ATGTCCAGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGAACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCCTAGGTC-GTTGTCTGTTTCGTCGCAT---TTATGCGC--ACGAAGCATACCCCAGGTT--ACCTGAC Phanacis_2 AG--CACACGTCCACTGCGGT-ATGTCCGGGGTC-GTCGGCGTGCACTTCTCCCCTAGTAGAACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGTTC-TGGGTG-GTTGCCTGTTCCGTTGTAT---TTATACGT--ACGGAGCATACTCCCGGTT--AACTGAC Eschatocerus GATACACACAATCACTGCGGT-ATGTCTAAATTCTGTCGGCGTGCACTTCTCCTCTAGTAGGACGTCGCGACCCGTTAGAATATTGATTT--ACGGCATAAATTTGATTGTTTGTATTAT-ATATA-TTTATTTATATATAATATATATCATAAATTT-GTNTAAT Diplolepis GG--CACACTGTCACTGCGGT-ATGTCTGAAGTTTGTCGGCGTGCATTTCTCCCTT-GTAGGACGTCGCGACCCGTTGGG-TGTCGGTTT--ACGGTCTAG-GTG-GTTGACTGTTTTGTCAAAA--TTTTTTTGT--ATAAAGCAGACCCCTGGAT--ACCTGAC Pediaspis TT--CACGCGTCCACTGCGTT-ATGTCCGGTGTC-GTCGGCGTGCACTTCTCCTCTAGTAGGACGTCGCGACCCGTTGGG-TGTCGGTTT--ACGGTCCGG-GTG-GTTGCCTGTTCTATCGTAC---TTGTTTACGTATAGAGCAGACCCTCGGTA--ATCTGAC Plagiotrochus AG--CACGCGTCCACTGCGTA-ATGTCCGGAGAC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTCT--ACGGTCCGG-GTG-GTTGCCTGTTCCGTCGCAT--TTTATGCGTT-GCGGAGCAGACCCCCGGTA--ACCCGAC Andricus CG--CACGCGTCCACTGCGGT-ATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTCCGTCGCAT--TTTATGCGC--ACGGAGCAGACCCCCGTGT--ACCCGAC Neuroterus GG--CACGCGTCCACTGCGGT-ATGTCTGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTCCGTCGCAT--TTTATGCGC--ACGGAGCAGACCCCCGTGT--ACCCGAC Biorhiza GG--CACGCGTCCACTGCGGT-ATGTCTGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTACGTCGCAT--TTTATGCGC--ACGGAGCAGACCCCCGTGT--ACCCGAC Parnips GG--CACACGTCCACTGCGGT-ATGCCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGCGACCCGTTGGG-TGTCGGTTT--ACGAACTGG-GTG-GTTGCCTGTTCCGTCGCATGAATAATGTGT--ATGGTGCAGACCCCTGGAT--ATCTGAC Paramblynotus GA--CACACGATCACTGCGGT-ATGTCTGAAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGCGACCCGTTGGG-TGTCGGTTT--ACGATCTAG-GTG-GTTGCCTGTTCCGTCACACA-TTACTGTGT--ACGGAGTAGACCCCTGGTT--ATCTGAC Ibalia AG--CACGCGGCCACTGCGGT-ATGTCTGGAGTC-GTCGGCGTGCACTTCTCCTCTAGTAGGACGTCGCGACCCGTTGGG-TGTCGGTTT--ACGGTCTGG-GTGCGTTGCCTGTTCCCTCGCATT-TACGTGCGC-TTGGGACCAGACCCCCGGTACTAACTGAC

Synergus CAACTGCCTGGCGGTACTCGTATGGTA-TCGGGCCGCACTTT----GTGCGTCGGGCCCGTCGCAAGCTAGATCAG-TGTT-TCTCGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GACGGTGT-TCTCGGACAGGCTCAT--TATGA Periclistus CAACTGCCCGACGGTACTCGTACGGTA-TCGGGCCGCACTTT----GTGCGTCGGGCCCGTCGCAAGCTTGAGCAG-TGTTATCCCGGATGTGCGGACCTAGTGCCGTCACCGGGCCTGGTCAGCTGTTGGTC-GACGGTGT-TCTCGGACTGGCTCAA--AACAA Ceroptres CAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTTT---TGTGCGTCGGGCCCGTCGCAAGCGAGATCAG-TGTT-ACCCGGATGTGCGGACCTAGTGCCGTCGCCGGGCCTGCTCAGCTGTTGGTC-GGCGGTGT-TCTCGGACTGGCTCAA--AATTA Synophromorpha CAACTGCCCGACGGTACTCGTACGGTA-TCGGGCCGCACTTT----GTGCGTCGGGCTCGTCGCAAGCGCGAGCAGGTGTTTATCCGGATGTACGGACCTAGTGCCGTCACCGGGCCTGATCAGCTGTTGGTC-GACGGTGTACCTCGGACTGGCTCAA--AATAA Xestophanes CAACTGCCCGACGGTACTCGTACGGTA-TCGGGCCGCACTTT----GTGCGTCGGGCCCGTCGCAAGCGCGAGCAGGTGTTTATCCGGATGTACGGACCTAGTGCCGTCACCGGGCCTGATCAGCTGTTGGTC-GACGGTGT-TCTCGGACTGGCTCAA--AATAA Diastrophus CAACTGCCCGGCGGTCCTCGTACGGTA-TCGGGCCGCACTCT----GTGCGTCGGGCCCGTCGCAAGCGCGAGCAG-TGTT-ACCTGGATGTGCGGACCTAGTGCCGTCACCGGGCCTGATCAGCTGTTGGTC-GACGGTGT-TCTCGGACTGGCTCAA------- Gonaspis CAACTGCCCGGCGGTCCTCGTACGGTA-TCGGGCCGCACTTT----GTGCGTCGGGCCCGTCGCAAGCGCGAGCAG-TGTT-ACCCGGATGTGCGGACCTAGTGCCGTCACCGGGCCTGATCAGCTGTTGGTC-GACGGTGT-TCTCGGACTGGCTCAA------- Liposthenes_gle CAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTTA---TGTGCGTCGGACTCGCCGCAAGCGAGATCAG-TGTT-ACCCGTAGGTATGGACATAGTGCCGTCCCCGGGCCTGATCAGCTGTTGGTC-GGCGATGT-TCTTAGACAGGCTCA---CCTAA Liposthenes_ker CAACTGCCCGGCGGTACTCGCATGGTA-TCGGGCCGCACT-A---TGTGCGTCGGGCCCGCCGCAAGCGAGATCAG-TGTT-TCCCGGAGGTGCGGACCTAGCGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCAGACAGGCTCA---TCTAA Antistrophus CAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCATTA----TGTGCGTCGGTCCCGCCGCAAGCGAGATCAG-TGTT-TCCCGGAGGTGCGGACCTAGAGCCGTCCCCGGGCCTGGTCAGCTGTTGGTT-GGCGGTGT-TCTTAGACAGGCTCA---TA-GA Rhodus CAACTGCCTGACGGTACTCGCACGGTA-TCGGGCCGCACTA----TGTGCGTCGGGCCCGCCGCAAGCGAGATCAG-TGTT-TCCCGGTGGTACGGACCTAGCGCCGTCACCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCAGACAGGCTCA---TACAA Hedickiana CAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTA----TGTGCGTCGGGCCCGCCGCAAGCGAGATCAG-TGTT-TCCCGGAGGTACGGACCTAGCGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCAGACAGGCTCA---TCCAA Neaylax CAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTA----TGTGCGTCGGGCCCGCCGCAAGCGAGATCAG-TGTT-TCCCGGAGGTACGGACCTAGCGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCAGACAGGCTCA---TCTAA Isocolus CAACTGCCTGGCGGTACTCGCACGGTA-TCGGGCCGCACTAA---TGTGCGTCGGGCCCACCGCAAGCGAGATCAG-TGCT-TCCCGGAGGTTCGGACTTAGCGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGTGGTGT-TCTCAGACAGGCTCA---TCGAA Aulacidea CAACTGCCCGGCGGTACTCGCACGGTA-TTGGGCCGCACTA----TGTGCGTCGGACCCGCCGCAAGCGAGATCAG-TGTTTTCCCGGAGTTACGGAGCTAGTGCCGTTCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCAGACAGGCTCAT--CAAAA Panteliella -AACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTA----TGTGCGTCGGGCTCGCCACAAGCGAGATCAG-TGTT-TCCCGGAGGTTCGGACCTAGCGCCGTCCCCGGGCCTGGTCAGCTGTTGGTT-GGCGATGT-TCTCAGACAGGCTCA---TCAAA Barbotinia CAACTGCTCGGCGGTACTCGCACGGTA-TCGAGCCGCACTA----TGTGCGTCGGGCCCGTCGCAAGCGAGATCAG-TGAT-ACCCGGATGTGCGGACCTAGTGCCGTCACCGGGCCTGGTCAGCTGTTGGCC-GACGGTGT-TCTCGGACAGGCTCAT--TC--- Aylax CAACTGCTCGGCGGTACTCGCACGGTA-TCGAGCCGCACTA----TGTGCGTCGGGCCCGTCGCAAGCGAGATCAG-TGTT-ACCCGGATGTGCGGACTTAGTGCCGTCACCGGGCCTGGTCAGCTGTTGGCC-GACGGTGT-TCTCGGACTGGCTCAT--TT--- Iraella CAACTGCTCGGCGGTACTCGCACGGTA-TCGAGCCGCACTA----TGTGCGTCGGACCCGTCGCAAGCGAGATCAG-TGTT-ACCCGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGGTCAGCTGTTGGCC-GGCGGTGT-TCTCGGACAGGCTCAT--TTTGA Timaspis CAACTGCCCGGCGGTACTCACACGGTA-TCGGGCCGCACTTA---CGTGCGTCAGGCCCGTCGCAAGCGAGATCAG-TGTTT-CCCGGAGGTGCGGACCTAGCGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GACGGTGT-TCTCTGACAGGCTCAT--TGAAA Phanacis_1 CAACTGCCCGGCGGTACTCGCACGGTA-TCGAGCCGCA-TTA---TGTGCGTCGGGCCCGTCGCAAGTGAGATCAG-CGTTA-CCCGGAGGTGCGGACCTAGCGCCGTCCCCGGGCCTGATCAGCTGTTGGTC-GGCGGTGT-TCTCTGACAGGCTCAT--C---A Phanacis_2 CAACTGCCCGGCGGTACTCGTATGGTA-TCGAGCCGCACTTA---TGTGCGTCGGGCCCGTCGCAAGCGAGATCAG-TGTTTACCCGGAGGTGCGGACCTAGCGCCGTCCCCGGGCCTGGTCAGCTGTTGGCC-GTCGGTGT-TCTCTGACAGGCTCAT--T---- Eschatocerus CAATTGTCTGACGGTACTAATAAGGGTATTGGGCCGCATTTTTAATATGCGTCTAATCCGTTACAAGCTAGAATTAGTGTT-ACTTAGTTTTACGAACCAAGTTTCGTTTCTGAGCCTAATCAGCTGTTGGTTTAGCGGTTAATCTTAGACTGGCTCAAAACATAC Diplolepis CGACTGCCCGGCGGTATTTGAACGGTAATCGAGCCGCACATA---AGTGCGTCAGGCCCACTGCAAGCGAGATCAG-TGTTAACCTGGAGGTGCGGACCTAGTGCCGTCCCCAGGCCTGGTCAGCTGTTGGTC-GGTGGTGT-TCTCGGACTGGCTCAT--AATTA Pediaspis CGACTGCTCGGCGGTACTCGTAAGGTA-TCGGGCCGCACTTG---TGTGCGTCGGGCCCGCTGCAAGCCGGATCAG-TGTT-ACCCGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGATCAGCTGTTGGTC-GGCGGTGT-TCTCGGACTGGCTCAT--CGAAA Plagiotrochus CAACTGCCCGGCGGTACTCGCAAGGTA-TCGGGCCGCACAT----TGTGCGTCGGGCCCGTCGCAAGCGAGATCAG-TGTTATCCTGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GACGGTGT-TCTCGGACTGGCTC----TAAAC Andricus CAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTTA---CGTGCGTCGGGCCCGTCGCAAGCGAGATCA-GTGTT-ACCCGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCGGACAGGCTCAT--CCAAA Neuroterus CAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTTA---CGTGCGTCGGGCCCGCCGCAAGCGAGATCAAGTGTT-TCCCGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCGGACAGGCTCAT--CCAAA Biorhiza CAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTTA---CGTGCGTCGGGCCCGTCGCAAGCGAGATCA-GTGTT-ACCCGGAGGTGCGGACCTAGTGCCGTCCCTGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCGGACAGGCTCAT--CCAAA Parnips CGACTGCCTGGCGGTACTCGCACGGTA-TCGAGCCGCACTA----CGTGCGTCGGGCCCGCCGCAAGCGAGATCAG-TGAT-ACCCGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCGGACTGGCTCAT--CTCAA Paramblynotus CGACTGCCCGGCGGTACTCGCACGGTA-TCGAGTCGCACTA----TGTGCGTCCGGCCCGCTGCAAGCGAGATCAG-TGTT-ACCCGGAGGTGCGGACCTGGTGCCGTCCCCGGGCCTGCTCAGCTGTTGGTT-AGCGGTGT-TCTCGGACTGACTCGT--CTCAG Ibalia CGACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTAA---GGTGCGTCGGACCCGCTGCAAGCGAGATCAG-TGAT-ACCCGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCAGACTGGCTCGT--TTGAA

Synergus -------------TACCGGTCGGCGACGCTACTGCTTTAGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGATCTTGCGTCGACTAAGGGAGGAT Periclistus TTAATA----TGATACCGGTCAGTGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGAT Ceroptres T----------GTTACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGAT Synophromorpha ATGA---------TACCGGTCAGTGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAA-CCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGAT Xestophanes ATGAA--------TACCGGTCAGTGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGAT Diastrophus -------------TACCGGTCAGTGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCATGCGTCCACTAAGGGAGGAT Gonaspis -------------TACCGGTCAGTGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTAAAGGTCGACCATGCGTCGACTAAGGGAGGAT Liposthenes_gle AAATT-----TGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGCAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGAT Liposthenes_ker AA--------TGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGAT Antistrophus AAA-------TGATACCGGTCGACGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGAT Rhodus AAATG-----ATATACCGGTCGGCGACGCTATTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGAT Hedickiana AAA-------TGATACCGGTCGACGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGAT Neaylax AAA-------TGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGAT Isocolus CA--------TGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCAAGTCATTGGGACTG--AAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGTGTCGACTG-GGGAGGAT Aulacidea TATTA-----TGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACAG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGAT Panteliella AA--------TGATACCGGTCGACGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGAT Barbotinia ATA-------TGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTACGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGAT Aylax ATA-------TGATACCGGTCAGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGAT Iraella ATA-------TGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACTG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGAT Timaspis AAAAT------GATACCGGTCAGCGACGCTATTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTACGCAAGTCATTGGGACTG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGAT Phanacis_1 AAAAT------GATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCAAGTCATTGGGATTG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGAT Phanacis_2 AAAAG------GATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCAAGTCATTGGGACTGG-TAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGAT Eschatocerus AATTTTTGTATGATACCTGTCAGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCAAGTCATTGGGATTTAATAAAACCTAAAGGCGTAATGAAAGTAAAGGTCGATCTTGTGTCGATTGAGGGAGGAT Diplolepis TA----------ATACCGGTCAGCGACGCTATTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACTT--GAAAACCTAAAGGCATAATGAAAGTGAAGGTCGGCCTTGCGTCGACTGAGGGAGGAT Pediaspis TGTTGTTATATGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACTG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGATCTTGCGTCGACTGAGGGAGGAT Plagiotrochus AATTG-----AAATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTTCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGAAATGAAAGTGAAGGTCGACCTCGCGTCGACTGAGGGAGGAT Andricus AT---------GATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGAT Neuroterus AT---------GATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGAT Biorhiza AT---------GATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGAT Parnips TTATT-----GAATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACTG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGAT Paramblynotus TTACT-----GAATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGATTTTGTGTCGACTAAGGGAGGAT Ibalia TGAAT-----CATTACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGATCG--CAAAACCTAAAGGCATAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGAT

Synergus GGGTT-GTGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTTGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Periclistus GGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Ceroptres GGGTT-GCGTTACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCTAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Synophromorpha GGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Xestophanes GGGTTTGCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTAAGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Diastrophus GGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Gonaspis GGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Liposthenes_gle GGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Liposthenes_ker GGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Antistrophus GGGTT-GCGTTACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACACATTACGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Rhodus GGGTT-GTGTCACGATGCAGCTCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Hedickiana GGGTT-GCATTACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Neaylax GGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Isocolus GGGCT-GCGTTACGATGCAGCCTCGCACTCCCGGGGCGTCTCGTACTCATTACGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Aulacidea GGGTT-ACGTTACGATGTAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTATGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Panteliella GGGTT-GCATCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Barbotinia GGGTT-ACGTTACGATGTAACCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Aylax GGGTT-GCGTTACGATGTAACCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Iraella GGGTT-ACGTTACGATGTAACCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Timaspis GAGCT-GCGTCACGATGCAGCTCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGGTGGAGGTCCGTAGCGATTCTGACGTG Phanacis_1 GGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Phanacis_2 GGGTT-ATATCACGATGTAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Eschatocerus GGGTT-ACATTACGATGTTTCCTCGCACTCCCGGGGCGTTTTATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Diplolepis GGACT-GTATTACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTACGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Pediaspis GGGTT-GCGTTACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Plagiotrochus GGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGCCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Andricus GGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Neuroterus GGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Biorhiza GGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Parnips GGGTT-GCGTTACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAATCCCTGATGGAGGTCCGTAGCGATTCTGACGTG Paramblynotus GGGTT-GTGTTACGATGCAATCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG Ibalia GGGCT-TCATCACGATGAAGCCCCGCACTCCCGGGGCGTCTCGTACTCAATGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTG

Synergus CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Periclistus CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Ceroptres CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Synophromorpha CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Xestophanes CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Diastrophus CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Gonaspis CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Liposthenes_gle CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Liposthenes_ker CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Antistrophus CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Rhodus CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Hedickiana CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Neaylax CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Isocolus CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Aulacidea CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Panteliella CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Barbotinia CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Aylax CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Iraella CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Timaspis CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Phanacis_1 CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Phanacis_2 CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Eschatocerus CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTTGCATTAAGCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Diplolepis CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGAGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Pediaspis CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGTGTGA-TTGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Plagiotrochus CAAATCGATCGTAGGAGCTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGAAGCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Andricus CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Neuroterus CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Biorhiza CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Parnips CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Paramblynotus CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT Ibalia CAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTAT

Synergus TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Periclistus TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Ceroptres TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Synophromorpha TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAATA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Xestophanes TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAATA-------------------------------------------------- Diastrophus TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAATA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Gonaspis TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAATA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Liposthenes_gle TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Liposthenes_ker TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Antistrophus TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAAAA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Rhodus TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Hedickiana TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCAAGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Neaylax TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Isocolus TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Aulacidea TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Panteliella TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTNAAGCCAC--------------------------------------- Barbotinia TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCATTTTT Aylax TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCATTTTT Iraella TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCATTTTT Timaspis TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAATA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Phanacis_1 TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Phanacis_2 TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Eschatocerus TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAATTTATGAAGCCATGAGATATAATTGGATCAGAGTGCCAAGTGGGCCAATTTT Diplolepis TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-TTGAAGCCATGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Pediaspis TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Plagiotrochus TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTTT-TCGGATCAGAGTGCCAAGTGGGCCAATTTT Andricus TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Neuroterus TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Biorhiza TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Parnips TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACG-GTGAAGCCATGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Paramblynotus TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACT-GTGAAGCCATGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Ibalia TCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACG-ATGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT ; end;

begin mrbayes; [This block sets up several different partitions that could be used in the analysis

of this dataset]

	outgroup Ibalia;

charset morphology = 1-166;

charset molecules = 167-3246;

charset COI = 167-1244;

charset COI_1st = 167-1244\3;

charset COI_2nd = 168-1244\3;

charset COI_3rd = 169-1244\3;

charset EF1a = 1245-1611;

charset EF1a_2nd = 1245-1611\3;

charset EF1a_3rd = 1246-1611\3;

charset EF1a_1st = 1247-1611\3;

charset LWRh = 1612-2092;

charset LWRh_2nd = 1612-2092\3;

charset LWRh_3rd = 1613-2092\3;

charset LWRh_1st = 1614-2092\3;

charset 28S = 2093-3246;

charset 28S_Stem = 2160-2267 2361-2401 2489-2528 2539-2565 2577-2647 2671-2760 2768-2827 2848-3194 3220-3246;

charset 28S_Loop = 2093-2159 2268-2360 2402-2488 2529-2538 2566-2576 2648-2670 2761-2767 2828-2847 3195-3219;

partition Names = 5: morphology, COI, EF1a, LWRh, 28S;

partition Nopart = 2: morphology, molecules;

partition Morph_mito_nucl_ribo = 4: morphology, COI, EF1a LWRh, 28S;

partition Extreme = 12: morphology, COI_1st, COI_2nd, COI_3rd, EF1a_2nd, EF1a_3rd, EF1a_1st, LWRh_2nd, LWRh_3rd, LWRh_1st, 28S_Stem, 28S_Loop;

end;

begin mrbayes;

[The following lines set up a model in which all four genes have their unique GTR + gamma + propinv model]

set partition=Names;

prset ratepr=variable;

lset applyto=(2,3,4,5) nst=6 rates=invgamma;

unlink shape=(all) pinvar=(all) statefreq=(all) revmat=(all);

end;

Personal tools